1. Protein Synthesis DNA to RNA to Proteins

2. DNA: Deoxyribonucleic Acid Video – https://youtu.be/zwibgNGe4aY https://youtu.be/zwibgNGe4aY – DNA carries genetic information but how? It must specify how to assemble proteins and How genes can be replicated or copied How genes get passed on to the next generation

3. DNA Unique molecule – Made up of nucleotides joined into long strands by covalent bonds – Nucleotides are made up of 3 components: 5-carbon sugar Phosphate group Nitrogenous base (contain nitrogen)

4. DNA Nitrogenous bases joined by covalent bonds – 4 kinds Adenine (A) Guanine (G) Thymine (T) Cytosine (C) Hmmmm? The Sun & DNA – Nitrogenous bases are sensitive to UV light – Due to chemical structure of bases – Why might this be important?

5. DNA Base pairing – A=T:G=C Hydrogen bonding – Weak bond – Allows for perfect bonding – Easy to dissemble, copy & reassemble Chargaff’s rule: – equal number of percentages of adenine and thymine – The same is true for guanine and cytosine

6. RNA Genes contain coded DNA instructions These instructions tell cells how to build proteins The first step in decoding the instructions is to copy the DNA sequence into RNA Why would we want to copy the DNA? Why not just used the DNA sequence directly?

7. RNA Master plan or blueprint – You want to keep the master safe, not risk losing it or making accidental modification – Make a copy that can be used and still have the original – Where do we keep original? In a safe place In the nucleus of the cell

8. RNA Ribonucleic acid – 5 carbon sugar = ribose – Phosphate group – Nitrogenous bases (4) Adenine Uracil Cytosine Guanine – Single strand

10. RNA RNA is a disposable copy of DNA segment A working copy of a gene Main job is protein synthesis – The assembly of amino acids into proteins

11. RNA & protein synthesis 3 types of RNA Each have a specialized role in protein synthesis – Messenger RNA (mRNA) – Ribosomal RNA (rRNA) – Transfer RNA (tRNA)

12. Compare and Contrast Compare and contrast DNA and RNA

13. RNA Synthesis = Transcription Begins in the nucleus DNA double helix is split RNA polymerase = enzyme Unzips the DNA pairs and reads the sequence Recoding for RNA – Adenine  Adenine – Thymine  Uracil – Guanine  Guanine – Cytosine  Cytosine

14. RNA Synthesis Step One: Transcription – The process of converting the DNA’s nucleotide sequence into a single strand of RNA – The RNA strand then leaves the nucleus and begins the process of making proteins Step Two: Translation – Outside the nucleus RNA is translated into amino acid language Step Three: joining the amino acids together – Then it begins the process of attaching amino acids together to form proteins

16. Proteins Made up of amino acids In translation nucleic acids are translated into amino acid language – 20 different amino acids – Based on codons A codon is a three-base “word” that codes for one amino acid Several codons form a “sentence” or protein (polypeptide)

17. Triplet Code Codon 3 bases code for a specific amino acid Each amino acid will code for several codons – Ex: phenylalanine (phe) will code for UUU and UUC – Ex: leucine (leu) will code for CUU, CUC, CUA, CUG Start codon – AUG begins the translation process Stop codons – 3 do not code for codons – They end the sequence – UAA, UAG and UGA Coding system is shared by almost all organisms

19. Transcription DNA TACCCAAATGGCTACGCATTACCGAAC mRNA

20. Translation mRNA tRNA Amino Acid