2. Molecular Genetics Chapter 12

3. DNA

4. 3

5. 4 DNA DNA. DNA is often called the blueprint of life. In simple terms, DNA contains the instructions for making proteins within the cell.

6. Who discovered the shape of DNA James Watson and Francis Crick 5

7. 6 DNA Why do we study DNA? We study DNA for many reasons, e.g., its central importance to all life on Earth, medical benefits such as cures for diseases, better food crops.

8. 7 Chromosomes and DNA Our genes are on our chromosomes. Chromosomes are made up of a chemical called DNA.

9. 8 The Shape of the Molecule DNA is a very long polymer. The basic shape is like a twisted ladder or zipper. This is called a double helix.

10. DNA is Made of Nucleotides One deoxyribose together with its phosphate and base make a nucleotide Draw this!

11. 10 One Strand of DNA The sides of the molecule (ladder) are alternating phosphates and deoxyribose sugar Between the 2 sides (Rungs) are nitrogenous bases. phosphate deoxyribose bases

12. 11 Four nitrogenous bases Cytosine C Thymine T Adenine A Guanine G DNA has four different bases:

13. 12 Two Stranded DNA Remember, DNA has two strands that fit together something like a zipper. The teeth are the nitrogenous bases but why do they stick together?

14. 13 C C C C N N O N C C C C N N O N N N C Hydrogen Bonds The bases attract each other because of hydrogen bonds. Hydrogen bonds are weak but there are millions and millions of them in a single molecule of DNA. The bonds between cytosine and guanine are shown here with dotted lines

15. 14 Chargraff’s Rule: Adenine and Thymine always join together A T Cytosine and Guanine always join together C G

16. ? If I had 30 Cytosines how many Thymines would there be?

17. 16 DNA by the Numbers Each cell has about 2 m of DNA. The average human has 75 trillion cells. The average human has enough DNA to go from the earth to the sun more than 400 times. DNA has a diameter of only 0.000000002 m. The earth is 150 billion m or 93 million miles from the sun.

18. DNA Replication

20. Why would DNA need to replicate????

21. DNA Replication  Replication = DNA copies itself exactly (Occurs within the nucleus)  Any mistake in copying = mutation

22. Basic Facts of DNA Replication 1. Complementary base pairing makes replication possible C - G A - T

23. Basic Facts of DNA Replication 2. One side of DNA molecule is a template for making the other side (strand)

24. Process of DNA Replication 1.Uncoil & unzip DNA molecule  Enzyme (-ase) breaks weak Hydrogen Bond between bases

25. Process of DNA Replication 2. Enzyme brings in complementary N-bases DNA Replicase

26. Process of DNA Replication 3. Insert N-bases

27. Replication Animation C - G A - T

28. Semi-conservative replication 1.Each new DNA molecule contains one old strand & one new strand

29. Comparing DNA Replication in Eukaryotes and Prokaryotes  Eukaryotic DNA unwinds in multiple areas as DNA is replicated.  In prokaryotes, the circular DNA strand is opened at one origin of replication.

31. Protein Synthesis

32. The DNA Code The order of bases along the DNA strand codes for the order in which amino acids are chemically joined together to form a polypeptide

33. Protein synthesis involves two types of nucleic acids: DNA (deoxyribonucleic acid) RNA (ribonucleic acid)

34. RNA RNA, like DNA, is a polymer formed by a sequence of nucleotides Three Types of RNA: messenger RNA (mRNA) transfer RNA (tRNA) ribosomal RNA (rRNA)

35. Differences Between DNA and RNA DNARNA double-strandedsingle-stranded sugar = deoxyribosesugar = ribose bases = A,T,C,Gbases = A,U,C,G (uracil takes the place of thymine)

37. Protein Synthesis involves two processes: 1.Transcription: the copying of the genetic message (DNA) into a molecule of mRNA 2.Translation: mRNA is used to assemble an amino acid sequence into a polypeptide

38. Transcription occurs in the nucleus of the cell 1) DNA strand separates and serves as a template (pattern) for mRNA assembly

39. 2) free mRNA nucleotides match up to the exposed nucleotides on the DNA strand

40. 3)mRNA strand leaves the DNA strand when a “stop codon” is reached 4)the mRNA strand carries the code for the production of one polypeptide

41. A sequence of 3 bases called a codon codes for one amino acid

43. Translation occurs in the cytoplasm of the cell, at the ribosome 1) mRNA moves out of the nucleus and into the cytoplasm to a ribosome

44. 2)mRNA is “read” by the ribosome and is converted to a chain of amino acids with the help of tRNA - Always begins with a start codon – AUG (methionine)

45. The Genetic Code

46. 4 different nucleotides means there are 64 possible triplets (codons)

48. 3)As the mRNA moves across the ribosome, tRNAs temporarily attach. The amino acids are joined by a chemical bond by enzymes until a stop codon (only 3) is reached 4) a polypeptide (protein) is produced

51. Now lets practice making a protein……

52. Gene regulation and Mutations

53. Mutations Any change in DNA sequence is called a mutation. – Mutations can be caused by errors in replication, transcription, cell division, or by external agents. If mutation occurs in gametes (sex cells) it will be passed on to offspring – A mutation may produce no change, a new trait, or it may result in a protein that does not work correctly. – If the mutation results in a protein that is nonfunctional, and the embryo may not survive. – In some rare cases a gene mutation may have positive effects.

54. Mutations If mutation takes place in a somatic cell, it is not passed on to organism’s offspring – Damage to a gene may impair the function of the cell – When that cell divides, the new cells also will have the same mutation – Some mutations of DNA in body cells affect genes that control cell division. – This can result in the cells growing and dividing rapidly, producing cancer.

55. Characteristics of Mutations One of the main sources of genetic variation. – Unique traits are thought to originate through mutations that are passed on Occur a random sometimes a mistake in base pairing during DNA replication. many mutations are caused by factors in the environment Mutagens- chemical or physical agent that causes mutations Can be classified as either: – Gene Mutations – Chromosomal Mutations (we will talk about this in ch. 11)

56. Gene Mutations Changes that affect the nucleotide sequence of a gene – change the DNA – changes the mRNA – may change protein – may change trait DNA TACGCACATTTACGTACG mRNA AUGCGUGUAAAUGCAUGC aa protein trait

57. Types of gene mutations Changes to the letters (A,C,T,G bases) in the DNA – point (or substitution) mutation change to ONE letter (base) may cause change to protein, may not – frameshift mutation addition of a new letter or deletion of a letter (base) in the DNA both of these shift the DNA so it changes how the codons are read big changes to protein!

58. Point Mutations One base change – can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN THEFATCARANDTHEREDRATRAN THEFATCATENDTHEREDRATRAN OR

59. Point Mutations Substitution mutation = may change amino acid AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUAUGCGAGUGA MetArgValTyrValCysGluStop

60. Sickle cell anemia- a single substitution Hemoglobin protein in red blood cells – strikes 1 out of 400 African Americans – limits activity, painful & may die young

61. Frameshift Mutations Add or delete one or more bases – changes the meaning of the whole protein as it changes how the mRNA codons are read. This change causes all remaining codons to be incorrectly grouped. The change in “reading frame” causes all resulting proteins to be made improperly. THEFATCATANDTHEREDRATRAN THEFATCANTANDTHEREDRATRAN THEFATCAANDTHEREDRATRAN OR

62. Frameshift Mutations Insertion = add one or more bases- AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUCAUGCGAGUGA MetArgValTyrValMetArgValA

63. Frameshift Mutations Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGAUGCGAGUGA MetArgValTyrAspAlaSerGA