1. pH=7.4 pH=6.8 unreplicated Lagging daughter Leading daughter Supplementary Figure 1: Separation of lagging daughter from unreplicated and leading daughter by CsCl gradient centrifugation. The fractions containing telomeric DNA were determined by slot blot.

2. pH 7.4 pH 6.8 0h6h Supplementary Figure 2: FACS analysis of synchronized HeLa cells released into S phase for different times (0h and 6h).

3. Internal Control (IC) AB Supplementary Figure 3: Decrease of telomerase activity in clones expressing different levels of shRNA (toward hTERT). (A) TRAP assay to detect telomerase activity in control, clone 7 and clone 14. Cell extract equal to indicated number of cells were used. (B) Quantification of A. Values are ±SD of three independent experiments. Telomerase products NC 50 100 200 50 100 200 50 100 200 Cell Number Heating Control Clone7Clone14

4. 01248 pHe 7.4pHe 7.1pHe 6.8 min A B C 16 01248 01248 D Supplementary Figure 4: Unchanged telomere chromatin structure under different pHes. (A) Western blot showed the decreased level of overall histone acetylation ( H4ac and H3K9ac) under acidic pHe. Bands were quantified by Image Q and normalized to the amount at pH 7.4. The fold of change was indicated below the bands. (B) ChIP assay demonstrated equal amount of acetylated histone at telomeres under indicated pHe. (C) Condensation of telomere chromatin was determined by micrococcal nuclease assay. (D) Quantification of C. There is no difference in sensitivity to micrococcal nuclease digestion. Values are ±SD of three independent experiments. H3K9ac H4ac Coomassie H3 pHe 7.4 7.1 6.8 1.0 1.0 0.34 1.0 0.97 0.62 1.0 1.0 1.01

5. TRF2 GAPDH ControlsgRNA-1sgRNA-2 Supplementary Figure 5: Validation of antibody against TRF2. HeLa cells were transfected with lenti-virus carrying inducible-Cas 9 (pHAGE-TRE-Cas9) and selected with neomycin for 10 days. SgRNAs (sgRNA-1 (CCTTTCGGGGTAGCCGGTA), sgRNA-2 (AACCCGCAGCAATCGGGACA in plasmids p-Lenti) were transiently transfected into the cells and induced with doxycyclin (1µg/ml) for 3 days. Cells were harvested for analysis. Empty vector was used as a control.

6. DAPIhTRCoilinMerge 7.4 7.1 6.8 A B Supplementary Figure 6: Colocalization of hTR with Cajal bodies under different pHe conditions. (A) Number of Cajal bodies in cells cultured at indicated pHe. (B) Colocalizaiton of hTR with Cajal bodies under indicated pH. Values are ±SD of three independent experiments.

7. Coilin Telo TRF2 Merge 7.17.4pH TRF2/Telo Coilin/Telo/TRF2 6.8 A B C Supplementary Figure 7: Cajal bodies are preferentially recruited to shorter telomeres that lack detectable TRF2. (A) Cajal Bodies and TRF2 are visualized by IF using antibody against coilin and TRF2, while telomeres are detected by FISH. (B) Quantification of A showing percentage of Cajal Body (CB) colocalized with TRF2- negative telomeres in cells grown at indicated pHe. (C) Quantification of A showing the length (RTL in FISH) of Cajal body (CB)-occupied telomeres and average length of total telomeres (CB-occupied plus CB-free telomeres) in cells grown at indicated pH. P value was calculated using the Student’s t-test.