1. Sabine Franke, PhD Sabine.Franke@chu.ulg.ac.be CHU Ulg Liège, Centre for Human Genetics 15. April 2016 ULG Acquired alterations of IGH and TCR loci in lymphoproliferative disorders Interuniversity course 2015/16 - HUMAN GENETCIS

2. Overview What are lymphoproliferative disorders? What are ‘IGH’ and ‘TCR’? What are IGH/TCR alterations How to detect IGH/TCR alterations?

3. Overview What are lymphoproliferative disorders? What are ‘IGH’ and ‘TCR’? What are IGH/TCR alterations How to detect IGH/TCR alterations?

4. Blood cell development major types of lymphocytes

5. Three major types of lymphocytes B cells T cells Natural killer (NK) cells

6. B cells are primary responsible for humoral immunity (relating to antobodies) T cells are involved in cell-mediated immunity. Function of B and T cells

7. B-cells Millions of different types of B cells each day In the blood and lymphatic system role of immune surveillance No production of antibodies until fully activated

8. 1) Combinatorial diversity (Somatic recombination) 2) Junctional diversity (Inaccurate junction) 3) Somatic hypermutation (Affinity maturing in germinal centres)

9. Gene rearrangements of the antigen receptor genes occur during the lymphoid proliferation Gene rearrangements of the antigen receptor genes occur during the lymphoid proliferation

10. Lymphoproliferative disorders (LPDs) LPDs refer to several conditions in which lymphocytes are produced in excessive quantities. Chronic lymphocytic leukemia (most frequent) 25% Acute lymphoblastic leukemia Hairy cell leukemia lymphomas Multiple myeloma Waldenstrom’s macroglobulinemia Wiskott-Aldrich syndrome Post-transplant lymphoproliferative disorder Autoimmune lymphoproliferative syndrome (ALPS) ‘Lymphoid interstitial pneumonia’

11. Lymphoid malignancy B lineage T lineage NK lineage Acute lymphoblastic leukemia – children 82 – 86% 14 – 18% < 1% – adults 75 – 80% 20 – 25% < 1% Chronic lymphocytic leukemias 95 – 97% 3 – 5% 1 – 2% Non-Hodgkin lymphomas – nodal NHL 95 – 97% 3 – 5% < 2% – extranodal NHL 90 – 95% 5 – 10% < 2% – cutaneous NHL 30 – 40% 60 – 70% < 2% Multiple myeloma100%0%0% B, T, and NK lineage of lymphoid malignancies

12. 1.Take home message Three major types of lymphocytes In LPDs lymphocytes are produced in excessive quantities Different lymphoid malignancies of different lineage origin

13. Overview What are lymphoproliferative disorders? What are ‘IGH’ and ‘TCR’? What are IGH/TCR alterations How to detect IGH/TCR alterations?

14. B-cell and T-cell receptors Image source: Immunobiology, 5th edition Janeway et al

15. Structure of the B-cell receptors The BCR is a membrane-bound immunoglobulin, and allows the distinction of B cells from other types of lymphocytes and is the main protein involved in B cell activation.

16. The ability to produce billions of different antibodies in humans results from the production of variable regions of light and heavy antibody genes by DNA rearrangement. The five major classes of heavy chain are IgM, IgG, IgA, IgD, and IgE. http://www.biology.arizona.edu Heavy chain (IGH) Light chain (IGL)

17. Schematic representation of an Immunoglobulin (IG)

18. Structur of the T-cell receptor Image source: Immunobiology, 5th edition Janeway et al

19. T-cell receptor gene rearrangement The variable domain of both the TCR α-chain and β-chain have three hypervariable or complementary determining regions (CDRs) Receptor for antigen on the majority of mature T-cells consists of two polypeptides alpha and beta that are linked by disulphide bonds and are associated with CD3 A small population of mature T-cells express a different TCR heterodimer in association with CD3. This is composed of two polypeptides designated gamma and delta

20. 2. Take home message Structure of the B and T cell receptor is important Ig and TCR consists of a variable and a constant region Ig consists of heavy and light chains

21. Overview What are lymphoproliferative disorders? What are ‘IGH’ and ‘TCR’? What are IGH/TCR alterations How to detect IGH/TCR alterations?

23. The production of variable regions of light and heavy antibody genes by DNA rearrangement.

24. stepwise rearrangement of V, D, and J gene segments Genes encoding antigen receptors are unique: -high diversity -developing lymphocytes through V(D)J rearrangement. The production of variable regions of heavy antibody genes by DNA rearrangement.

25. These V-J gene rearrangements generate products that are unique in length and sequence in each cell resulting in diverse antigen expressing B cells.

26. B cell development

27. StageHeavy chainLight chain Progenitor (or pre-pro) B cellsgermline Early Pro (or pre-pre)-B cellsundergoes D-J rearrangementgermline Late Pro (or pre-pre)-B cellsundergoes V-DJ rearrangementgermline Large Pre-B-cellsis VDJ rearrangedgermline Small Pre-B cellsis VDJ rearranged undergoes V-J rearrangement Immature B cellsis VDJ rearrangedVJ rearranged Mature B cellsis VDJ rearrangedVJ rearranged Cell development.

28. T cell rearrangement

29. Estimated diversity of human Ig and TCR molecules IgH Igα Igג TCR α β γ δ moleculesmolecules Number gene segments V gene segments~44 ~43 ~38 ~46 ~47 ~6 ~6 D gene segments 27 2 3 J gene segments 6 5 4 53 13 5 4 Combination diversity >2x10 6 2x10 6 <5000 Junctional diversity ++ + + + ++ ++ ++++ Total diversity >10 12 >10 12 >10 12

30. Possible variation through recombining gene fragments? Over 15,000,000 combinations of variable, diversity and joining gene segments are possible. Imprecise recombination and mutation increase the variability into billions of possible combinations.

31. 3. Take home message Gene rearrangements of the antigen receptor genes occur during the lymphoid proliferation B-cells: Stepwise rearrangement of V, D, and J gene segments Unique products of V(D)J rearrangements resulting in diverse antigen expressing B-cells

32. Overview What are lymphoproliferative disorders? What are ‘IGH’ and ‘TCR’? What are IGH/TCR alterations How to detect IGH/TCR alterations?

33. Clinically relevant testing B-cell versus T-cell malignancy (origine) Reactive versus malignant New lymphoma versus recurrence Assessment of remission and relapse Bone marrow involvement Evaluation of treatment effectiveness

34. Analysis Techniques Detecting gene rearrangements of the antigen receptor genes Discrimination between monoclonal and polyclonal Ig/TCR gene PCR products

35. PCR D iscrimination between monoclonal and polyclonal Ig/TCR gene PCR products GeneScanning analysis Fast, accurate, sensitive non-quantitative monitoring of clonal proliferations Need sequence equipment Heteroduplex analysis Sensitivity ~5-10% available to most laboratories

36. Design of novel primer sets for detection of Ig/TCR rearrangements BIOMED-2 study (multiplex PCR) Ig genes: IGH: VH-JH and DH-JH IGK: V  -J  and Kde rearrangements IGL: V -J TCR genes: TCRB: V  -J  and D  -J  TCRG: V  -J  TCRD: V  -J , D  -D , D  -J , and V  -D 

37. BIOMED-2 clonality strategy Suspected B-cell lymphoma Suspected lymphoma of unknown origin Suspected T-cell lymphoma IGH V(D)J FR1, FR2, FR3 IGH DJ(A) IGK-VJ and DE TCRGVJ (A and B) TCRB V(D)J (A and B) TCRB DJ

38. CTGTGCAAGAG CTGTGCAAGAG CCTCTCTCCACTGGGATCGGGGCC CTTTGACTACTGG ……….. Van Dongen et al Leucemia 2003

39. CTGTGCAAGAG CCTCTCTCCACTGGGATCGGGGCC CTTTGACTACTGG

40. Van Dongen et al Leucemia 2003

41. PCR GeneScan analysis region

42. Example BIOMED-2 multiplex IGH VH-FR2–JH Use of controls

43. Analysis of TCRB gene rearrangements

45. From the patient to the analysis Selection of material Protocol Check DNA quality Clonality analysis

46. Examples of cases Case 1: Lymphoma? Reactive? Case 2: Relapse? Case 3: T-cell lymphoma

47. Case 1 Female 63 years Lymphoma in dec. 2004 FR1 polyclonal, FR3 monoclonal Feb. 2009 biopsy Relapse?

48. Case 1: GeneScan analysis of controls H2O

49. Case 1: Relapse? FR3 12/2004 2/2009 Biopsie FR3: 152 bp 12/2004 Biopsie FR3: 152 bp 2000 600

50. Case 1: Results Controls ok B-cell targets: IGH(VDJ) FR3 clonal Conclusion of the molecular results: Clonal rearrangement of the IGH gene was detected in this specimen. This gene rearrangement profile is identical to the one detected in the biopsie of 12/2004 and confirms the relapse of the disease.

51. Case 2 Female 81 years Biopsie Lymphoma?

52. Case 2 3/2009 biopsie FR1 327,11 bp control 2700 100

53. Case 2: Results Controls ok B-cell targets: IGH(VDJ) FR1 monoclonal FR2 monoclonal Conclusion of the molecular results: Clonal rearrangements of the IGH gene were detected in this specimen. This gene rearrangement profile fits to the presense of a monoclonal B-cell population/B-NHL.

54. Case 3: Male 75 years Lymphoma origine? 2 biopsies First results: FR1, 2, 3 kappa polyclonal

55. Case 3: TCRG

57. Use of clonality analysis 1.Making the diagnosis Normal  reactive  malignant 2.Assessment of remission and relapse Normal  reactive  malignant 3.Involvement (staging) 4.Evaluation of treatment effectiveness Detection of minimal residual disease (MRD) MRD-based risk-group stratification (treatment reduction or treatment intensification)

58. Gene rearrangements of the antigen receptor genes occur during the lymphoid proliferation These gene rearrangements generate products that are unique in length and sequence in each cell. In a clonal population (from one cell) all cells have the identical gene rearrangement. Unique length allows by PCR discrimination of monoclonality and polyclonality Standardized protocol (BIOMED-2) 4. Take home message