1. DNA Replication Each single strand of DNA contains the information needed to generate its complementary strand Meselson and Stahl demonstrated that DNA replication was semiconservative about 5 years after DNA structure was elucidated 1

2. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach 2 dNMPs = Deoxy Nucleoside Monophosphates Nucleoside vs Nucleotide? Mono- vs tri-phosphate (dTTP is a dNTP) DNA REPLICATION

3. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach Cartoon: formation of a phosphodiester bond during DNA replication

4. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach 4 dNTPs = Deoxy Nucleoside Tri-phosphates - used by DNA Polymerase Pyrophosphate (PPi) released in reaction

5. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach 5 Axis of symmetry Diameter of helix Determined by Pyr:pur pair Base-stacking leads to twist

6. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach 6 Minor groove (6Å) Major groove (12Å) Sites for protein binding….

7. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach Palindromes as targets for DNA Restriction Endonucleases Restriction endonucleases = Restriction Enzymes – cut within DNA strands and usually recognize palindromic DNA sequences Palindrome in English language… reads the same from left to right or from right to left: ANNA 7

8. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach Palindromes as targets for DNA Restriction Endonucleases Palindrome in DNA: 5’ to 3’ on upper strand = 5’ to 3’ on lower strand EXAMPLE: EcoRI recognition sequence: Flip, turning sequence 180 o 5’GAATTC3’ Flip: 5’GAATTC3’ 3’CTTAAG5’ 3’CTTAAG5’ NOT a mirror-image flip: 5’GAATTC3’ Flip: 3’CTTAAG5’ 3’CTTAAG5’ 5’GAATTC3’ 5’CCGTAAGGCTGAATTCGAACGCGTTG3’ 3’GGCATTCCGACTTAAGCTTGCGCAAC5’ Flip: 5’CAACGCGTTCGAATTCAGCCTTACGG3’ 3’GTTGCGCAAGCTTAAGTCGGAATGCC5’ 8

9. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach Palindromes as targets for DNA Restriction Endonucleases Palindrome in DNA: 5’ to 3’ on upper strand = 5’ to 3’ on lower strand NOTE: palindrome within non-palindromic sequences – strands are anti-parallel, but NOT palindromic 5’CCGTAAGGCTGAATTCGAACGCGTTG3’ 3’GGCATTCCGACTTAAGCTTGCGCAAC5’ Flip: 5’CAACGCGTTCGAATTCAGCCTTACGG3’ 3’GTTGCGCAAGCTTAAGTCGGAATGCC5’ 9

10. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach Origin of Replication in Bacterial DNA DNA replication is most often bidirectional, proceeding in both directions There is a single origin of replication in (circular) bacterial chromosomes 10

11. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach 11 Representative Cairns autoradiograph of replicating (circular) bacterial DNA - 1963

12. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach 12 If replication began where shown (origin), but were unidirectional, where would replication terminate?

13. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach 13 D. Melanogaster chromosome

14. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach Multiple Replication Origins in Eukaryotes Autoradiograph analysis shows multiple origins of replication on eukaryotic chromosomes Large eukaryotic genomes contain thousands of origins of replication separated by 40,000 to 50,000 base pairs (40kb to 50kb) The human genome contains more than 10,000 origins DNA replication rate varies among different types of cells Not all origins “fire” at the same time: early and late- replicating regions of the genome. What is early and what is late differs among cell types. 14

15. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach 7.4 DNA Replication Precisely Duplicates the Genetic Material Replication has been most extensively studied in bacteria Though replication is very similar among Bacteria, Archaea, and Eukarya, the processes are not identical The enzymes and proteins involved are parts of large complex aggregations of proteins and enzymes called replisomes These assemble at each replication fork 15

16. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach 16 A conserved Origin of Replication (ori) in bacteria

17. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach Replication Origins Comparison among the SINGLE replication origin in chromosome of various bacterial species identified consensus sequences (not identical sequences) = tandem repeats of 13-mer and 9-mer. Multiple Replication origins in yeast (eukaryote) – “ARS = autonomously replicating sequences” – again = conserved DNA sequences Replication origins in other eukaryotes – no conserved DNA sequence – so harder to identify as origins… 17

18. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach HELICASE: Binds to origin and begins unwinding two DNA strands SINGLE STRANDED DNA BINDING PROTEIN (SSB): binds each single strand to prevent reannealing PRIMASE: synthesizes an RNA primer, using single-stranded DNA as template DNA POLYMERASE: adds deoxynucleotides to 3’end of RNA primer and growing DNA strand Conserved activities of the “REPLISOME” (bacteria, archaea, eukaryotes)

19. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach DNA vs RNA 1.The most stable form of DNA is as a double- stranded helix but the most stable form of RNA is as a single strand 2.The ribose in DNA is NOT oxygenated (no hydroxyl group) at Carbon #2 (deoxy) while the ribose in RNA IS oxygenated at Carbon #2 (hydroxyl group) 3.The four nucleotides in DNA are A,T,G,C, but the four nucleotides in RNA are A,U,G,C 19

20. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach 20 Note: No “deoxy” in the name No “thymidine”

21. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach 21 Leading strand = nucleotide addition in direction of fork movement

22. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach 22

23. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach 23 Unwinding two strands puts stress on a closed double-helix (circular genome). Topisomerase relieves this stress… Special problem of closed, circular genome

24. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach Cartoon of DNA replication

25. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach SLIDING CLAMP: Anchors DNA polymerase to DNA template and keeps it moving – “high processivity” 5’ to 3’ exonuclease + 5’ to 3’ DNA polymerase: degrades RNA primer and replaces ribonucleotides with deoxyribonucleotides (Kornberg- first DNA polymerase isolated and characterized = DNA Pol I). Note: what is an “exonuclease” vs an “endonuclease?” LIGASE: closes (phospho-diester bond) single-strand gap between Okazaki fragments on lagging strand and between adjacent lagging/leading strand fragments Additional conserved activities of the “REPLISOME” (bacteria, archaea,eukaryotes)

26. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach 26 Proliferating-cell nuclear antigen = PCNA (in eukarya and archae)

27. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach 27 (GGA-OH +PPP-T-OH)GGAT-OH Moving fork (DNA Polymerase’s 5’ exonuclease activity) and so on… DNA Polymerase’s 5’ to 3’ polymerase activity

28. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach 28 (GCG -OH + P- GATG)

29. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach 29 NOTE: two forks moving away from each other; leading strand from one fork Must be joined to Okazaki fragments of lagging strand from the other fork

30. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach DNA Proofreading DNA replication is very accurate, mainly because DNA polymerases undertake DNA proofreading, to correct occasional errors Uncorrected errors in replication occur about one every billion nucleotides (10 9 ) in E. coli Proofreading ability of DNA polymerase enzymes is due to a 3 to 5 exonuclease activity 30

31. Copyright © 2012 Pearson Education Inc. Genetics Analysis: An Integrated Approach 31