1. Induction of the cathelicidin related antimicrobial peptide in blood of mice after Orientia tsutsugamushi infection Intorduction Sang-Hee Park, Jung-Hyun Lee, Soo-Kyung Shim, Young-Sill Choi, Kyu-Jam Hwang, Mi-Yeoun Park Division of Zoonoses, Center for Immunology & Pathology, National Institute of Health, Korea Center for Disease Control & Prevention, 194, Tongil- Lo, Eunpyung-Gu, Seoul, 122-701, Korea Orientia tsutsugamushi is an obligate intracellular parasitic bacterium and a causative agent of scrub typhus, which is a prevalent febrile disease in Korea transmitted by chiggers. The experimental study of inbred mice infected with O. tsutsugamushi has contributed to our understanding of O. tsutsugamushi–host relationships and protective immune mechanisms. Many of O. tsutsugamushi strains have shown to have different levels of virulence in inbred mice. However, the mechanisms underlying this pathogenicity of mice have not been defined clearly. In this study, to elucidate the molecular basis for immune and defense mechanism of O. tsutsugamushi, we analyzed the blood of mice infected with O. tsutsugamushi using Micorarray and Real-time PCR. Material and Method Results Conclusion Bacteria strains : The O. tsutsugamushi Boryong, Kuroki, and 3 strains of isolates were cultivated in L929 cell was grown in RPMI medium containing 10% FBS. Mouse infection : The O. tsutsugamushi Boryong, Kuroki, and 3 strains of isolates infected to BALB/c mice. Seven to eight week-old BALB/c male mice were injected intraperitoneally with 0.2 ml of serum-free RPMI containing approximate 6 X 10 4 ICU (Infected cell units) of O. tsutsugamushi. RNA isolation and Microarray : Total RNA was prepared using Blood RNA kit (PAXgene) from blood of mice infected after 2 weeks. The RNA transcripts from the infected samples were converted into cDNA and labeled using Chemiluminescent RT-IVT Labeling Kit (Applied Biosystems). GeneChip (AB 1700 mouse chip, Macrogene) analysis was performed by using Applied Biosystems reagents and protocols.. Data analysis : Differences in microarray intensities were normalized and grouped using the Avadis Prophetic software (Strand Genomics). Statistical Analysis was performed by Quantile normalization and fold change method. Biological process and molecular function of genes classified using PANTHER database (http://www.pantherdb.org/). RNA isolation and Real-time quantitative PCR : Total RNA was prepared using Blood RNA kit (PAXgene) from blood of mice infected during 2 weeks. CRAMP-F (GGATGACTTCAACCAGCAGTCC) and CRAMP-R (TCCAGGAGACGGTAGAGATTGG) to amplify CRAMP cDNA; GAPDH-F (TTGTCAAGCTCATTTCCTGGTATG) and GAPDH- R GCCATGTAGGCCATGAGGTC) were used to amplify GAPDH. One microliter reverse-transcriptase reaction was used in 23.5 μL SYBR Green PCR Master Mix (Applied Biosystems) and 0.25 μL of each 10 μM primer. The thermal profile was as follows: 50°C for 2 min, 95°C for 10 min, 40X (94°C for15 s, 60°C for 1 min). Testing of antimicrobial activity : L929 cells grown in 96-well plates were incubated with O. tsutsugamushi for 3hr, allowing time for O. tsutsugamushi to attach to and enter the host cells. At the end of the initial incubation period, the inoculums were replaced with fresh medium containing two-fold dilutions of CRAMP (PANATecs) from 100 µg/mL to 0.048 µg/mL, and the cells were then re-incubated in 5% CO2 at 37 ℃. After 4 hrs of incubation with 5% CO2 at 37 ℃, bacterial growth was determined by IFA. 1. In mice Orientia tsutsugamushi infection model, CRAMP was strongly up-regulated and confirmed by real-time quantitative PCR. 2. The sensitivity of O. tsutsugamushi Boryong to the synthetic CRAMP showed antimicrobial activity in vitro. 3. The CRAMP were associated with immune and defense in O. tsutsugamushi infection. Probe IDGene NameB182432 Antibacterial response protein 749630cathelicidin related antimicrobial peptide (CRAMP)14.4819.0017.775.88 824050toll-like receptor 215.3312.9115.572.86 433999toll-like receptor 136.806.367.612.17 644812neutrophilic granule protein68.60168.78261.3720.93 Complement component 421348complement receptor 2-5.98-4.59-9.17-2.16 675339complement component 1, q subcomponent, gamma polypeptide6.7610.658.902.38 796692histocompatibility 2, complement component factor B34.427.8320.803.81 Immunoglobulin receptor family member 444829Unassigned-2.23-3.54-2.80-8.03 845230natural cytotoxicity triggering receptor 1-2.29-3.50-2.03-3.02 498083CD79B antigen-4.84-4.68-4.34-3.96 581699expressed sequence BB219290-3.63-5.21-3.23-2.99 479671Unassigned-2.87-6.40-5.30-3.04 520081CD19 antigen-3.30-2.55-3.48-3.00 328650membrane-spanning 4-domains, subfamily A, member 8A20.477.4918.942.28 682726Fc receptor, IgG, alpha chain transporter3.772.402.223.15 652532RIKEN cDNA B430010N18 gene7.085.816.616.63 Other defense and immunity protein 387887membrane-spanning 4-domains, subfamily A, member 1-3.53-2.80-3.26-2.11 References Braff MH, Zaiou M, Fierer J, Nizet V, Gallo RL. Keratinocyte production of cathelicidin provides direct activity against bacterial skin pathogens. Infect Immun. 2005;73:6771-6781. Fukuhara M, Fukazawa M, Tamura A, Nakamura T, Urakami H. Survival of two Orientia tsutsugamushi bacterial strains that infect mouse macrophages with varying degrees of virulence. Microb Pathog. 2005;39:177-187. Nizet V, Ohtake T, Lauth X, Trowbridge J, Rudisill J, Dorschner RA, Pestonjamasp V, Piraino J, Huttner K, Gallo RL. Innate antimicrobial peptide protects the skin from invasive bacterial infection. Nature. 2001;414:454-457. Yun JH, Koh YS, Lee KH, Hyun JW, Choi YJ, Jang WJ, Park KH, Cho NH, Seong SY, Choi MS, Kim IS. Chemokine and cytokine production in susceptible C3H/HeN mice and resistant BALB/c mice during Orientia tsutsugamushi infection. Microbiol Immunol. 2005;49:551-557. Table 1. The Genes process that protect the body against foreign substances or diseases by either nonspecific or specific mechanisms from O. tsutsugamushi infection experiments. The fold changes of expression of genes are compared with O. tsutsugamushi Kuroki, nonpathogenic strain to BALB/c mice. (B, fold changes of expression genes of mice during O. tsutsugamushi Boryong infection; 18, O. tsutsugamushi isolate 18; 24 O. tsutsugamushi isolate 24; 32, O. tsutsugamushi isolate 32) Fig. 3. Antimicrobial activity of CRAM to O. tsutsugamushi Boryong and the activity of different concentrations of CRAMP were compared. Fig. 2. CRAMP expression pattern in blood of mice during O. tsutsugamushi infection. Lines represent the mean of three Q-PCR replicates in indicated time after infection and Error bars indicate SEM. (B, CRAMP expression of mice during O. tsutsugamushi Boryong infection; 18, O. tsutsugamushi isolate 18 infection; 24, O. tsutsugamushi isolate 24 infection; K, O. tsutsugamushi Kuroki infection) Fig. 1. Clinical symptoms including loss of mobility and ruffled fur in mice Orientia tsutsugamushi infection model. (A, Uninfected mice; negative control, B, O. tsutsugamushi Kuroki infection; nonpathogenic to mice, C, O. tsutsugamushi Boryong infection: pathogenic to mice) A B C