1. Case studies of transcriptional regulation
Dr Mike Dyall-Smith, lab 3.07
Types of transcriptional regulation
The first ‘engineered’ promoter: the tac promoter
A high level, tightly-controlled expression vector: the pET system

2. Promoter specificity: sigma factors
Lewin, Schaecter et al.

3. Transcriptional repression or activation

4. From Schaecter et al.

5. Types of transcriptional control of gene expression
From Schaecter et al.

6. Types of transcriptional control of gene expression
From Schaecter et al.

7. Types of transcriptional control of gene expression
Translation can affect transcription
From Schaecter et al.

8. ATTENUATION - the trp operon (tryptophan biosynthesis genes)
From Schaecter et al.

9. ATTENUATION - the trp operon (tryptophan biosynthesis genes)
From Schaecter et al.

10. ATTENUATION - the trp operon
Two alternate secondary structures can form
termination
Anti-termination: allows transcription of all trp genes
From Schaecter et al.

11. ATTENUATION - the trp operon
From Schaecter et al.

12. The tac promoter.
The tac promoter: a functional hybrid derived from the trp and lac promoters.
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
Dr Mike Dyall-Smith, 2007

13. The tac promoter: a functional hybrid derived from the trp and lac promoters.
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
Important paper, but in 1983
this was before PCR
enzymes and oligonucleotides expensive
sequencing moderately difficult
personal computers not common
Dr Mike Dyall-Smith, 2007

14. The tac promoter: a functional hybrid derived from the trp and lac promoters.
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
1983:
Bacterial promoters still poorly understood. Relative efficiencies unexplored.
Hybrid promoters never before made.
Here they could switch the -35 box from trp to lac and achieve a higher transcription rate of HGH in E.coli
Dr Mike Dyall-Smith, 2007

15. The tac promoter: a functional hybrid derived from the trp and lac promoters.
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
What was desired for biotechnological production of enzymes and hormones in E.coli was a highly regulated promoter, that could be easily turned ON (from OFF) when cells were grown in standard rich medium in a large fermentor.
Why do you need to control the promoter ?
Dr Mike Dyall-Smith, 2007

16. The tac promoter: a functional hybrid derived from the trp and lac promoters.
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
The promoters used in these studies were:
Tryptophan (trp) operon: genes involved in tryptophan biosynthesis. Needed most of the time - except when Trp is in the environment, then it needs to be shut down (repressed)
Lactose (lac) operon: needed rarely, only when environment is low in glucose but high in lactose. In this case, the lac operon is induced.
Dr Mike Dyall-Smith, 2007

17. trp operon controlled by repression
NEGATIVE CONTROL of transcription
Tryptophan synthesis is shut down if Tryp is available from the medium.
Tryp acts as a co-repressor to repress biosynthesis
From Genes V, Lewin
Dr Mike Dyall-Smith, 2007

18. Control systems for the lac operon
CAP
LacI
Senses lactose via allolactose
Senses low glucose via cAMP levels
From Genes V, Lewin
Dr Mike Dyall-Smith, 2007

20. Activity of lac operon depends on cAMP+CAP and inducer+LacI
RNAP
+ve
CAP
P O1
lacI
lacZ, Y, A...
CAP site
High cAMP (=low glucose)
Lactose (-> allolactose)
Dr Mike Dyall-Smith, 2007
From Genes V, Lewin

21. Consensus Bacterial Promoter Sequence (recognized by RNA polymerase-sigma70)
Startpointof transcription
Three main parts, the -35, -10 consensus sequences and the start point (usually purine)
Fig 14.14, Genes V (Lewin)
Dr Mike Dyall-Smith, 2007

22. lacUV5 promoter: -10 mutant
lac UV5    TTTACA TATAAT
lac wild-type  TTTACA TATGTT
17 is best
Consensus promoter
lac UV5 has a -10 hexamer mutation that makes it identical to consensus in that region.
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
Dr Mike Dyall-Smith, 2007

23. trp and lac promoters: Consensus promoter 17 is best
lac UV5    TTTACA TATAAT
trp   TTGACA TAACTA
17 is best
Consensus promoter
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
Dr Mike Dyall-Smith, 2007

24. Consensus Bacterial Promoter - gives strongest initiation of transcription
trp promoter had a perfect (consensus) -35 box
lac promoter had a perfect (consensus) -10 box
- could a consensus promoter be constructed that retained lacI regulation ?
Fig 14.14, Genes V (Lewin)
Dr Mike Dyall-Smith, 2007

25. trp and lac operators lac O1
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
Dr Mike Dyall-Smith, 2007

26. A hybrid promoter -> consensus sequence
lac O1
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
Dr Mike Dyall-Smith, 2007

27. Construction of hybrid promoters
-35
-10
lac O1
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
Dr Mike Dyall-Smith, 2007

28. Source of trp and lac promoters
HpaII
TaqI
TCGA
AGCT
CCGG
GGCC
T . .
AGC
CGG
. . C
ligate
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
Dr Mike Dyall-Smith, 2007

29. Source of trp and lac promoters
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
Dr Mike Dyall-Smith, 2007

30. tacI promoter construction
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
Dr Mike Dyall-Smith, 2007

31. tacI promoter construction
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
Dr Mike Dyall-Smith, 2007

32. Production of HGH using lac UV5 and tacI promoter constructs
Inducer added
This shows tacI can be repressed and induced effectively, better than lacUV5
lacUV5
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
Dr Mike Dyall-Smith, 2007

33. Production of HGH using lac UV5 and tacI promoter constructs
IPTG Inducer added
Tested in an E.coli strain (D1210) with a mutant lacI gene, lacIq, which over-expresses the lacI repressor.
lacUV5
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
Dr Mike Dyall-Smith, 2007

34. Inducers of the lac operon
Dr Mike Dyall-Smith, 2007

35. lacIq mutation: up-promoter
caccatcgaatggtgcaaaacctttcgcggtatggcatgat
caccatcgaatggcgcaaaacctttcgcggtatggcatgat
-35
-10
Not close to consensus to begin with. Why?
Higher levels of LacI protein in cell. What effect would this have on regulation?
Dr Mike Dyall-Smith, 2007

36. lacI
lacZ P O3 O1 O2
The lac operon has THREE lac repressor recognition sites in a stretch of 500 bp; at the positions of three operator sites, O1, O2, and O3.
O1 lies within the promoter.
O2 lies 401 bp downstream of O1, within the lac Z gene.
O3 is in the lac I gene, 93 bp upstream of O1
* O2, O3 much weaker than O1 O3 O1
From Genes V, Lewin
Dr Mike Dyall-Smith, 2007

37. Promoter-reporter plasmid
This was constructed to measure the relative strengths of promoters.
Galactokinase is an easily measured enzyme.
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
Dr Mike Dyall-Smith, 2007

38. Promoter-reporter plasmid results
Multicopy plasmid titrates out lacI (they added IPTG also), and tac promoters lack trpR operator, so they are fully de-repressed.
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
Dr Mike Dyall-Smith, 2007

39. Promoter-reporter plasmid results
Want to see maximum promoter activity so:
Multicopy plasmid titrates out lacI
To be sure, they added IPTG also, to remove any LacI that could bind.
tac promoters lacked a complete trpR operator
To be sure, they grew in very low tryp medium
e) To see if there was any possibility that the TrpR repressor may be lowering the level of transcription they tested a trpR- host (HDB2)
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
Dr Mike Dyall-Smith, 2007

40. trp promoter about 2x lac promoter
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
Dr Mike Dyall-Smith, 2007

41. Surprise: trpR is still repressing trp promoter under these conditions.
So the trp promoter is really 3x stronger than lac promoter.
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
Dr Mike Dyall-Smith, 2007

42. tac promoters ~ 7-11x lac promoter
But the ratios are not as good if you take the higher value for trp.
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
Dr Mike Dyall-Smith, 2007

43. Promoter-reporter plasmid results
HDB2 = trpR- and C600 = trpR+
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
Dr Mike Dyall-Smith, 2007

44. The tac promoter: a functional hybrid derived from the trp and lac promoters.
de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25
SUMMARY
They produced a functional hybrid promoter.
tacI gave far stronger promoter activity than the natural lac or trp promoters.
Expressed HGH under inducible control using tacI
That was How would you do it nowdays?
Did they show the HGH was active?
Dr Mike Dyall-Smith, 2007

45. Physician Prescribed Human Growth Hormone (hGH)
Human growth hormone (hGH) replacement therapy is one of the most promising of all the anti-aging treatments. Ongoing medical research and clinical studies indicate that six months of hGH replacement therapy can reverse several bio-markers of aging by TEN to TWENTY years! Reported effects of human growth hormone therapy include: decreased body fat, increased lean mass, increased bone density, increased energy levels, improved skin tone and texture, improved immune system function, and a greater sense of well-being.
Dr Mike Dyall-Smith, 2007

46. Tighter control, Higher expression?
The pET system of expression vectors and E.coli host strains, developed by Novogen
Key elements:
Use a T7 phage RNA polymerase - highly specific
Clone gene under T7 promoter control (not recognised by E.coli RNA pol.) + lacO (and lacI)
Use tight control of T7 RNA polymerase expression (phage infection or lacUV5 control of T7 gene)
Can include plasmid pLys expressing T7 lysozyme, a natural inhibitor of T7 RNA pol (mops up small levels)

47. pET series of expression vectors
Gene of interest cloned downstream of a T7 consensus promoter sequence, and a lacO sequence.
Transcription can only occur when… ?
pET plasmid
Novogen

48. pET series of expression vectors
Source of T7 RNA polymerase: T7 gene is integrated into the host cell chromosome, and its promoter has been changed to lac, with the lacO.
T7 RNAP will only be produced when …. ?

49. pET series of expression vectors
Lac promoter, even when repressed is leaky, and will produce a small amount of mRNA and so, a bit of T7 RNAP.
Can include another gene, coding for T7 lysozyme, that is expressed at low levels, and inhibits T7 RNAP

52. SUMMARY
Various types of transcriptional control of gene expression. (sigma factor, repression, activation, attenuation)
tac promoter designed to provide the best characteristics of the trp and lac promoters for high level, but tightly controllable gene expression
pET vectors are more recent, and provide tighter control (particularly where the product is toxic to the cell), and much higher transcription rates.
Dr Mike Dyall-Smith, 2007