1. 1 PROTEIN SYNTHESIS

2. DNA and Genes

3. DNA DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells

4. 4 Genes & Proteins  Proteins are made of amino acids linked together by peptide bonds  20 different amino acids exist

5. 5 Polypeptides Amino acid chains are called polypeptides or proteins

6. 6 DNA Begins the Process DNA is found inside the nucleus Proteins, however, are made in the cytosol of cells by organelles called ribosomes Ribosomes may be free in the cytosol or attached to the surface of rough ER

7. 7 Starting with DNA DNA‘s code must be copied and taken to the cytoplasm This is transcription.DNA‘s code must be copied and taken to the cytoplasm This is transcription. In the cytosol, this code must be read so amino acids can be assembled to make polypeptides (proteins). This is called translationIn the cytosol, this code must be read so amino acids can be assembled to make polypeptides (proteins). This is called translation These two processes together are called PROTEIN SYNTHESISThese two processes together are called PROTEIN SYNTHESIS

8. RNA

9. 9 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan

10. 10 RNA Differs from DNA RNA has a sugar riboseRNA has a sugar ribose DNA has a sugar deoxyribose

11. 11 Other Differences RNA contains the base uracil (U)RNA contains the base uracil (U) DNA has thymine (T) RNA molecule is single-strandedRNA molecule is single-stranded DNA is double- stranded DNA

12. 12. Three Types of RNA Messenger RNA (mRNA) copies DNA’s code & carries the code for proteins to the ribosomesMessenger RNA (mRNA) copies DNA’s code & carries the code for proteins to the ribosomes Ribosomal RNA (rRNA), along with protein, makes up the ribosomesRibosomal RNA (rRNA), along with protein, makes up the ribosomes Transfer RNA (tRNA) transfers (carries) amino acids to the ribosomes where proteins are synthesizedTransfer RNA (tRNA) transfers (carries) amino acids to the ribosomes where proteins are synthesized

13. 13 Messenger RNA Long Straight chain of Nucleotides Made in the Nucleus Copies DNA & leaves through nuclear pores Contains the Nitrogen Bases A, G, C, U ( no T )

14. 14 Messenger RNA (mRNA) Carries the information for a specific proteinCarries the information for a specific protein Made up of 500 to 1000 nucleotides longMade up of 500 to 1000 nucleotides long Sequence of 3 bases called codonSequence of 3 bases called codon

15. 15 Ribosomal RNA (rRNA) rRNA is a single strand Globular in shaperRNA is a single strand Globular in shape Made inside the nucleus of a cellMade inside the nucleus of a cell Bonds with proteins to form ribosomesBonds with proteins to form ribosomes Site of protein SynthesisSite of protein Synthesis

16. 16 The Genetic Code A codon designates an amino acid An amino acid may have more than one codon There are 20 amino acids, but 64 possible codons Some codons tell the ribosome to stop translating

17. 17 Remember the Complementary Bases On DNA: A-T C-G On RNA: A-U C-G

18. Transcription and Translation

19. 19 Pathway to Making a Protein DNAmRNA tRNA (ribosomes) Protein

20. 20 Protein Synthesis   The production or synthesis of polypeptide chains (proteins)  Two phases: Transcription & Translation  mRNA must be processed before it leaves the nucleus of eukaryotic cells

21. 21 DNA  RNA  Protein Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

22. 22 Transcription The process of copying the sequence of one strand of DNA, the template strand mRNA copies the template strand Requires the enzyme RNA Polymerase

23. 23 Template Strand

24. 24 Question:  What would be the complementary RNA strand for the following DNA sequence? DNA 5’-GCGTATG-3’

25. 25 Answer: DNA 5’-GCGTATG-3’DNA 5’-GCGTATG-3’ RNA 3’-CGCAUAC-5’RNA 3’-CGCAUAC-5’

26. 26 Editing mRNA After the DNA has been copied by mRNA, it must be edited before it goes to the ribosome. Introns are segments of DNA that do NOT code for an amino acid. It is this DNA that makes us all different.

27. 27 mRNA Editing Exon are segments of DNA that code for proteins. The newly processed mRNA can then leave the nucleus

28. 28 mRNA Transcript mRNA leaves the nucleus through its pores and goes to the ribosomes

29. 29 Translation Translation is the process of decoding the mRNA into a polypeptide chain or protein Ribosomes read mRNA three bases or 1 codon at a time and construct the proteins

30. 30 Transcription Translation

31. 31 Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1

32. 32