Download presentation
Presentation is loading. Please wait.
Published byShona Moore Modified over 8 years ago
1
1 The world leader in serving science Toinette Hartshorne, Ph.D. Senior Staff Scientist Genetic Analysis Applications New flexible solutions for high throughput genotyping of CFTR mutations For Research Use Only. Not for use in diagnostic procedures.
2
2 What is Cystic Fibrosis? Cystic Fibrosis is an autosomal recessive inherited genetic disease Cystic Fibrosis is the most common, fatal genetic disease in European - derived populations 1/2500 Caucasian births High carrier frequency: approximately 1 in 25 individuals -Caused by defective CFTR gene: Cystic Fibrosis Transmembrane Conductance Regulator protein -Cl- ion transporter
3
3 Lack of flexibility in content selection Fixed panels, some limited to only 23 targets Limited flexibility in throughput Maximum of hundred of sample/instrument/day Long turnaround time 8 to up to 48 hours High cost per sample Commercially available platform limitations CFTR Mutation Testing challenges *National Human Genome Research Institute: https://www.genome.gov/10001213https://www.genome.gov/10001213
4
4 Platform solution for evaluating CFTR mutations KingFisher™ & MagMAX™ DNA Extraction KingFisher™ & MagMAX™ DNA Extraction QuantStudio™ Systems QuantStudio™ Systems Flexible Formats Flexible Formats Flexible, Scalable, Low cost Various Sample Types Various Sample Types TaqMan™ Assays TaqMan™ Assays
5
5 TaqMan Assay Technology Broad assay collection available 7 Million Predesigned TaqMan SNP Genotyping Assays 2,700 TaqMan Drug Metabolism Assays 200 Qualified CFTR TaqMan Assays Custom TaqMan Assays Gold Standard technology - Universal PCR protocol -4 hours PCR reaction with OpenArray plate format -2 hour PCR reaction with 96- and 384-well plate formats
6
6 Most common CFTR mutations around the world
7
7 Design custom panels from a menu of 198 CFTR targets Majority coverage of CFTR2 mutation list
8
8 CFTR Qualified Assays Performance Testing Evaluated performance and concordance metrics Repeatability and Reproducibility studiesgDNAs samples: cell line, blood, buccal Tested candidate assays with synthetic templates Normalized homozygous & heterozygous plasmid controls Tested assays with 47 Coriell gDNAs with known CFTR genotypes 384-well and OpenArray plates on QuantStudio 12K Instrument Designed and tested >400 unique assays to ~200 CFTR targets Key mutations: ACMG panel, CFTR2, collaboratations, mutation frequency
9
9 Study included 64 Whole Blood gDNA samples: 28 CF Positive Samples & 36 WT Samples Representative Data Shown F508delN1303KW1282X3659delC High Performance Results with TaqMan OpenArray and 384-well Plates
10
10 CFTR TaqMan SNP Genotyping Assays set 200 assays to 198 CFTR mutation targets Challenging targets genotyped with non-standard TaqMan assays: Assays that overlap another mutation, e.g. F508del regionHomopolymer mutations, e.g. 2184insA regionPoly T tract 5T/7T/9T polymorphismLarge deletions
11
11 Assay probes for these clustered mutations specifically identify their mutation target, and fail to bind amplicons containing a nearby, underlying non-target mutation. e.g. F508del mu/mu samples are not detected by assays to the 4 nearby variants. Clustered mutation targets: F508del region assays F508del assay probes overlap I506V, I507del, I507V, F508C ACCATTAAAGAAAATATCAT[-/CTT]TGGTGTTTCCTATGATGAAT (E) Control Coriell gDNA samples run on OpenArray plates
12
12 Homopolymer targets: 2184delA region assays 2184delAc.2052delAp.Lys684AsnfsX38 CTGTCTCCTGGACAGAAACAAAAAA[A/-]CAATCTTTTAAACAGACTGGAGAGT 2183delAAc.2051_2052delAAp.Lys684ThrfsX4 CTGTCTCCTGGACAGAAACAAAAA[AA/-]CAATCTTTTAAACAGACTGGAGAGT 2183AA->Gc.2051_2052delAAinsGp.Lys684SerfsX38 CTGTCTCCTGGACAGAAACAAAAA[AA/G]CAATCTTTTAAACAGACTGGAGAGT 2184insAc.2052_2053insAp.Gln685ThrfsX4 CTGTCTCCTGGACAGAAACAAAAAAA[-/A]CAATCTTTTAAACAGACTGGAGAG Homopolymer indels are usually not amenable to TaqMan assay design ACMG panel (7 > 6 As)
13
13 PolyT tract 5T/7T/9T assays and data analysis Genotype5T assay result 7T (TT) = VIC / 5T (-) =FAM 9T assay result 9T (TT) =VIC / 7T (-) = FAM 5T/5T-/--/-, und, or noamp 5T/7TTT/-TT/TT 5T/9TTT/-TT/TT, und 7T/7TTT/TT-/- 7T/9TTT/TTTT/- 9T/9TTT/TT The 5T/7T/9T alleles are a component of the intron 8 polyAG/polyT mutation 5T affects CFTR RNA splicing, resulting in low levels of CFTR protein 5T is incompletely penetrant; impact is most severe when in cis with R117H Whole blood gDNA samples run on OpenArray plates 5T9T
14
14 CFTRdele2,3 and CFTRdele22,23 large deletions are interogated by a pair of modified copy number assays: Wild type (wt) and mutant (mu) allele assays are run separately. Each assay contains one functional probe (wt = VIC; mu=FAM) Heterozygous samples amplify with both assays; homozygous wild type samples only amplify with the wild type assay. Large deletions: CFTRdele2,3 & CFTRdele22,23 Control Coriell gDNA samples run on OpenArray plates CFTRdele2,3 het CFTRdele2,3 wild type Manually called as ‘no amp’ CFTRdele2,3 het CFTRdele2,3 mutation
15
15 Control kit available with full coverage of all 200 qualified CFTR TaqMan Assays CFTR TaqMan Assay Controls Kit Contains 18 control plasmids, 3 kb on average Each plasmid contains heterozygous sequences for 10 to 14 targets Recommend testing plasmid controls with wild type gDNA F508delN1303KW1282X3659delC CFTR synthetic controls used to generate HET mutation results
16
16 Sample-to-answer workflow for CFTR mutation testing Genotyping Workflow Run Assays on QuantStudio System Sample Type: Whole blood Buccal Swab KingFisher Flex System with MagMax kits OpenArray AccuFill System for sample loading Genotyping data for rare allele detection* CFTR mutation Results OR 384-well Plates * TaqMan Genotyper™ Software or Thermo Fisher Cloud GT App
17
17 QuantStudio 12K Flex Enables Breadth in Content and Format Flexibility Individual Assays in Tubes: Flexible, any instrument TaqMan Arrays 384 well microfludic cards Custom assay panels TaqMan Assay Plates – FAST & Standard 96 well & 384 well optical plates Custom plating of assays Choice of 4 formats TaqMan OpenArray Plates 3,072 well array plate; highest throughput Lowest cost per rxn Approximately 1-2 minutes to exchange the block / heated cover / plate holder. No re-calibration required
18
18 Flexible content Custom panels from 24 to 180 assays per plate Flexible throughput From 6 to 576 samples/instrument/day Complete workflow From blood/buccal cell sample to genotype Low cost per sample Key benefits Qualified CFTR TaqMan Assay offering
19
19 Real-Time PCR Using OpenArray® Technology http://www.thermofisher.com/CFTR For Research Use Only. Not for use in diagnostic procedures. © 2016 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified. TaqMan is a registered trademark of Roche Molecular Systems, Inc., used under permission and license. Poster P01.020D Monday afternoon
20
20 Flexibility to customize your own panels TaqMan SNP Genotyping Assays Number of Samples 26X96 60X48 120X24 180X16 240X12 HydrophilicHydrophobic 33 nL OpenArray Plate Technology
Similar presentations
© 2024 SlidePlayer.com. Inc.
All rights reserved.