1. DNA and Protein Synthesis

2. 1/21 Warm-up The building blocks of proteins are ______ ______. Imagine you are in your room (without any electronic devices). You have a written message you must give your friend, but you cannot leave your room. How will you get that message to your friend? amino acids

3. 1/22 Warm-up Fill out the Venn diagram, glue in your journal.

4. DNA Sequence: T-A-C-A-G-C-G-C-G-A-A-A-C-T-T-G-G-C-T-T-T-G-G-T-A-A-C-A-T-C mRNA Codon: Amino Acid: tRNA DNA TRIPLETmRNA CODON AMINO ACID attached to tRNA ANTICODON AA: tRNA: AA: tRNA: AA: tRNA: AA: tRNA: AA: tRNA: AA: tRNA: AA: tRNA: AA: tRNA: AA: tRNA: AA: tRNA:

5. DNA Triplet- TACAGCGCGAAACTTGGCTTTGGTAACATC mRNA Codon- AA (Amino Acid) tRNA (Anitcodon)-

6. 1/24 Warm-up

7. w V x W

8. 1/29 Warm-Up Get out one sheet of notebook paper # 1-15 Only thing on your desk should be journal and sheet of notebook paper!

9. 1/27 Warm-up

10. Nucleotide Deoxyribose Sugar

11. Nucleotides are made of…. Phosphate Sugar Nitrogen Base The sugar in DNA is… Deoxyribose

12. 4 Nitrogen Bases Thymine  Adenine Guanine  Cytosine

13. Nitrogen Bases-DNA Thymine  Adenine Guanine  Cytosine

14. http://www.youtube.com/watch?v=q y8dk5iS1f0

15. Scientists to Know Pg. 255 Rosalind Franklin (4 th Paragraph) -What did she study? -What did the photos suggest? Watson and Crick (Last Paragraph) -What did Watson observe? -What did he immediately know? -What did Watson and Crick complete? What year? Chargaff (2 nd Paragraph) -What did he find? -Give an example -What is Chargaff’s rule?

16. Rosalind Franklin Studied x-ray diffraction to determine the structure of DNA

17. Chargaff’s Rule Base pairing rule A-T C-G

18. DNA Replication Top of Pg.257 -Each cell needs to pass exact ______ of DNA to ________ cells (when cells divide). -Each strand can be used to make the other ________. -This is referred to as __________. -Example: (Please write the complementary strand to): TTAGACGTA - AATCTGCAT

19. DNA replication http://www.youtube.com/watch?v=teV62zr m2P0 (Pre-AP)http://www.youtube.com/watch?v=teV62zr m2P0 http://www.youtube.com/watch?v=zdDkiR w1PdUhttp://www.youtube.com/watch?v=zdDkiR w1PdU

20. ReplicationProcess Start at #4 Pg.258 The enzyme Helicase (#4) -unwinds and ________the double ______ strand of ________. -This process is referred to as _______ -The unzipping breaks the _______ bonds The enzyme DNA Polymerase -Adds free-floating _________ one at a time to the exposed bases (#5) - If there are no mistakes, the result is ________ identical copies of DNA (#6)

21. Open-Note Quiz 1.Name the three components of a nucleotide. 2.Adenine pairs with _________ 3.Guanine pairs with _________ 4.The complimentary strand of TACGGT is ________. 5._________ is the scientist who used x-rays to study DNA. 6._________ is the scientist who found nitrogen bases occur in the same proportion. 7._______ and ______ are the two scientists credited with the discovery of the DNA Structure. 8.The enzyme that “unzips” DNA is __________. 9.Organism’s must pass __________ copies of DNA to daughter cells (cell division) 10._____________ is the enzyme that adds nucleotides in DNA replication.

22. Open Note Quiz-PreAP 1.Name the three components of a nucleotide. 2.What molecule transfers heredity info from one generation to the next? 3._________ is the scientist who found nitrogen bases occur in the same proportion (A-T, C-G). 4.Nitrogen bases are attached to what molecule? 5.Molecules that end in “ase” are proteins called_______. 6.The enzyme that “unzips” DNA is __________. 7._____________ is the enzyme that adds nucleotides in DNA replication. 8.The complimentary strand of TACGGT is ________. 9.Organism’s must pass __________ copies of DNA to daughter cells (cell division) 10.Replication occurs in the _________ of the cell.

23. RNA and Protein Synthesis Pg. 325 One of the most important functions of DNA is to provide instructions for making proteins DNA is too large to leave the__Nucleus_____. The DNA uses another molecule known as _mRNA______ to help make _Proteins_______. Differences of RNA and DNA (3 rd Paragraph) -RNA has the sugar _Ribose______. -RNA _Can____ (can or cannot) leave the nucleus -RNA has _Uacil______(U), while DNA has Thymine (T) -RNA is __single_____ strand, while DNA is _double______ strands

24. Types of RNA Pg. 326 (1 st paragraph) 1. mRNA -__Single_____(single or double?) strand -hold the DNA message for creating _protein______. -made in Transcription, when it copies the __DNA_____ code -breaks away from DNA, and travels to the _Ribosome________

25. Codons Pg 326 (#5) Codons - separated into groups of _Three________. example: (copy the example below) -mRNA: AUCGCCUUC AUC/GCC/UUC Now look at the amino acid chart of Pg. 327 -AUC= Isolecuine -GCC=? Alanine -UUC=? Phe

26. Types of RNA Pg 326 (2 nd paragraph) 2. tRNA -reads the mRNA (codon) sequence, and assembles __amino_____ _acids_____ into chains of proteins.

27. Protein Synthesis Step 1 Trans c ription (pg 329) -copies DNA into a complimentary strand of mRNA -copy the example: DNA strand: TAC GGT AAT GTG CAG mRNA strand: AUG CCA UUA CAC GUC *notice the U replaces T in RNA

28. Protein Synthesis Step 2 Trans l ation (Pg. 330) -The mRNA code is translated into a __Protein________. Copy summary @ the top of 331. Glue picture of Protein Synthesis and condon chart into your journals. Title: Protein Synthesis in Cell.

35. Protein Synthesis Mutations Clips Protein Synthesis http://www.youtube.com/watch?v=NJxobgkP EAo Mutation http://www.brainpop.com/science/cellularlife andgenetics/geneticmutations/

36. Open Note Quiz 1.DNA is too large to leave the _________. 2.RNA is made with ________ sugar. 3._______ replaces thymine in RNA. 4._______ copies the message from DNA to make proteins. 5.mRNA is made in the _________. 6.Codons are separated into groups of ______. 7._______ carries amino acids to the ribosome. 8.______ _____ link together to make proteins. 9.In translation, mRNA is translated into ________. 10.__________ is the process where mRNA copies DNA’s recipe to make a protein.

37. Open-Note Quiz Pre-AP 1._______ copies the message from DNA to make proteins. 2._______ carries amino acids to the ribosome. 3.RNA is made with ________ sugar. 4._______ replaces thymine in RNA. 5.________ is the process in which mRNA is produced. 6.The process in #5 takes place in the _______. 7._______ carries amino acids to the ribosome. 8.______ _____ link together to make proteins. 9.In translation, mRNA is translated into the molecule __________. 10.________ are the 3 nitrogen bases on the mRNA that the “Met” tRNA docks upon?