1. Unit 3.1 – Protein Synthesis

2. DAY 1 Journaling Question: Why is the gene that gives your freckles in your skin, not expressed in your pancreas?

3. Journal Questions  A question given to you every few days  To be checked on Tuesdays during Eagle time Mrs. Nedrow and Mrs. Mahan’s class go to other Bio teacher  Turn all 6 in with test  Receive 6 extra credit points (1/q)

4. RNA vs. DNA DNA  Double stranded  Deoxyribose sugar  Bases: C,G A,T RNA  Single stranded  Ribose sugar  Bases: C,G,A,U Both contain a sugar, phosphate, and base.

7. Protein Structure  Made up of amino acids  Polypeptide- string of amino acids  20 amino acids are arranged in different orders to make a variety of proteins  Assembled on a Ribosome

8. Questions to be answered today  How do we get from the base sequences found in DNA to a bunch of amino acids?  How do we get from a bunch of amino acids to proteins?

9. Replication DNA double helix unwinds DNA now single-stranded New DNA strand forms using complementary base pairing (A-T, C-G) Used to prepare DNA for cell division Whole genome copied/replicated DNA makes new DNA

10. Transcription and Translation: An Overview (aka the Central Dogma) DNA RNA Protein Transcription Translation

11. Transcription and Translation  Cells are governed by a cellular chain of command  We call this the “Central Dogma” DNA RNA protein traits  Transcription Is the synthesis of RNA under the direction of DNA Produces messenger RNA (mRNA)  Translation Is the actual synthesis of a polypeptide, which occurs under the direction of mRNA Occurs on ribosomes We’ll start discussing this process tomorrow.

12. DAY 2

13. Warm Up  What type of RNA copies DNA? mRNA  What is this process called? Transcription

14.  RNA forms base pairs with DNA C-G A-U (NOT T)  Primary transcript- length of RNA that results from the process of transcription

15. TRANSCRIPTION ACGATACCCTGACGAGCGTTAGCTATCG UGC UAU GGGACU

16. Major players in transcription  mRNA- type of RNA that encodes information for the synthesis of proteins and carries it to a ribosome from the nucleus Messenger RNA

17. Major players in transcription  RNA polymerase 2 functions: Unwind DNA sequence strings together the chain of RNA nucleotides Does what both Helicase and DNA Polymerase did in DNA Replication

18. mRNA Processing  Primary transcript is not mature mRNA  DNA sequence has coding regions (exons) and non-coding regions (introns)  Introns must be removed before primary transcript is useful mRNA and can leave nucleus

19. Let’s Practice!

20. DAY 3

21. Warm Up  Separate this DNA sequence into codons ATTGCGATGTCGGCTGACCCC  Transcribe this sequence & Splice out UAA  What is this process called and why is it important? Gene splicing, to control gene expression

22. Transcription is done…what now? Now we have mature mRNA transcribed from the cell’s DNA. It is leaving the nucleus through a nuclear pore. Once in the cytoplasm, it finds a ribosome so that translation can begin. We know how mRNA is made, but how do we “read” the code?

23. Translation  Second stage of protein production

24. Translation  Translation is the RNA-directed synthesis of a polypeptide  Translation involves: mRNA Ribosomes - Ribosomal RNA Transfer RNA Genetic coding - codons

25. Section 11.2 Summary – pages 288 - 295 As translation begins, one end of mRNA strand coming from the nucleus attaches to a ribosome. mRNA strand Ribosome Step 1 Translation from mRNA to Protein

26. Reading the DNA code  Every 3 DNA bases pairs with 3 mRNA bases  Every group of 3 mRNA bases encodes a single amino acid  Codon- coding triplet of mRNA bases

27. How many bases code for each amino acid?  3 bases = 1 codon  1 codon = 1 amino acid  3 bases = 1 amino acid

28. Section 11.2 Summary – pages 288 - 295 tRNAs bring amino acids to the ribosomes. Translation from mRNA to Protein RIBOSOME mRNA Coming from Nucleus Step 2

29. Each tRNA only carries one amino acid. Transfer RNA Bound to one amino acid on one end Anticodon on the other end that complements the mRNA codon Amino acid

30. Section 11.2 Summary – pages 288 - 295 There are also three nucleotides on the bottom of the tRNA called an anti-codon. Anti-codons complementary base pair with the codons on mRNA. (this is to make sure they are bringing the correct amino acid- If the anti-codon doesn’t base pair with the codon, then the wrong amino acid was brought) Anti-codon

31. AUG is the first codon on the mRNA strand. This signals the ribosome to START making a protein A tRNA with anticodon UAC comes and binds with this codon and drops off it’s amino acid “Methionine”. Methionine

32. Section 11.2 Summary – pages 288 - 295 After the first tRNA binds with its codon, the mRNA slides down so that the ribosome can read the next codon. Step 3

33. Section 11.2 Summary – pages 288 - 295 A new tRNA molecule carrying an amino acid pairs with the second mRNA codon. Alanine Step 4

34. Section 11.2 Summary – pages 288- 295 The amino acids then bond together. Once the first tRNA lets go of it’s amino acid, it is released from the ribosome. AlanineMethionine bond Step 5

35. Section 11.2 Summary – pages 288 - 295 A chain of amino acids is formed until the stop codon is reached on the mRNA strand. Stop codon The end result is a protein

36. Transcription vs. Translation Review Transcription  Process by which genetic information encoded in DNA is copied onto messenger RNA  Occurs in the nucleus  DNA mRNA Translation  Process by which information encoded in mRNA is used to assemble a protein at a ribosome  Occurs on a Ribosome  mRNA protein

37. PRACTICE!!!

38. DAY 4

39. Warm Up  Translate the following mRNA strand into an amino acid strand using the codon chart.  AUGCACUGUCCUUUCGCUGAC

40. The Genetic Code  Genetic information is encoded as a sequence of nonoverlapping base triplets, or codons

41. So now we get to the codon table!  Locate the first letter of your codon using the left side of the table.  Ex. AUG  Look for the A

42.  Now move to the second letter of your codon which is ‘U’  Look across the top of the table Find the letter ‘U’ and follow it down until it intersects with the letter ‘A’ from the left side(1 st letter).  You should see four amino acids (isoleucine, isoleucine, isoleucine, and (start) methionine. Codon: AUG

43.  Down to the last letter of the codon!  Look to the right hand side for the third letter. Find the letter ‘G’ which will intersect with the box that had the four choices.  Trace from the ‘G’ on the left over to the left and you should land on ….. Methionine (start)  Yes you did it!!!  Now try another codon Codon: AUG

44. Try the codon CAC Did you get the amino acid ‘histidine’?

45. What do these codons have to do with proteins?  Each codon represents an amino acid that will eventually form a protein that is used within a cell.  Proteins are made up of hundreds of amino acids in a specific sequence.  When they get “out of order’ a mutation occurs. Long string of amino acids will form

46. ACGATACCCTGACGAGCGTTAGCTATCG UGC UAU GGGACUGCU

47. Let’s Practice…

48. DAY 5

49. Warm Up  What is a mutation? Any changes that take place in DNA  Explain how a mutation can be a benefit to an organism. The classic example of evolutionary change in humans is the hemoglobin mutation that makes red blood cells take on a curved, sickle-like shape. With one copy, it resists malaria, but with two copies, it causes the illness of sickle-cell anemia.

50. 11.3 Section Summary 6.3 – pages 296 - 301 Mutations Any change in DNA sequence is called a mutation. Mutations can be caused by errors during replication, transcription, translation, or cellular division.

51. Types of Mutations you need to know:  Point Mutations  Frameshift Mutations Insertion Deletion

52. 11.3 Section Summary 6.3 – pages 296 - 301 Mutations on sex cells (gametes) - passed on to offspring. Some mutations are inherited from parents If a sperm or egg cell has a mutation and is fertilized, the altered gene would become part of the genetic makeup of the offspring. Every cell in that person would contain the mutation.

53. 11.3 Section Summary 6.3 – pages 296 - 301 Sometimes a mutation can have no effect at all. For instance, if a codon sequence was suppose to be AUU Why would it have no effect on the person if a mutation caused the codon sequence to be AUC

54. 11.3 Section Summary 6.3 – pages 296 - 301 What happens if powerful radiation hits the DNA of a body cell, such as in skin, muscle, or bone? If a body cell’s DNA is changed, this mutation would not be passed on to offspring. Some mutations occur “randomly” in BODY CELLS (any cell that is not a sex cell) Will that affect this person’s offspring?

55. 11.3 Section Summary 6.3 – pages 296 - 301 A point mutation is a change in a single base pair in DNA. Result: A change in a single nitrogenous base can change the structure of a protein causing it to not function properly. Types of Mutations THE DOG BIT THE CAT. THE DOG BIT THE CAR. Does this one letter change the meaning of the entire sentence?

56. 11.3 Section Summary 6.3 – pages 296 - 301 Normal Point mutation mRNA Protein Stop mRNA Protein Replace G with A Because one base was changed from a G to an A, it caused the wrong amino acid to be put in the protein. It is called a point mutation, because it happens at one point.

57. 11.3 Section Summary 6.3 – pages 296 - 301 A mutation in which a single base is added or deleted from DNA is called a frameshift mutation because all the codons shift from one base. Also may be called: deletion mutation or insertion mutation Deletion of U Types of Mutations

58. 11.3 Section Summary 6.3 – pages 296 - 301 Deletion of U Instead of just one amino acid being wrong, this changes ALL the amino acids after the mutation. This causes much bigger problems than a point mutation. Types of Mutations Result:

59. Nondisjunction (Trisomy or Monosomy)  Entire chromosome affected Either an extra or a missing copy  should have 2 of each chromosome  23 chromosome pairs – 1 from each parent…that’s 46 total in humans  Example: Trisomy 21 (Down Syndrome) Extra copy of chromosome 21

60. Translocation  Involves two chromosomes  Part of one chromosome is transferred to another chromosomes

61. 11.3 Section Summary 6.3 – pages 296 - 301 Many mutations are caused by factors in the environment, such as radiation, chemicals, and even high temperatures. Causes of Mutations Any external agent that can cause a change in DNA is called a mutagen.

62. 11.3 Section Summary 6.3 – pages 296 - 301 Repairing DNA Enzymes proofread the DNA and replace incorrect nucleotides with correct nucleotides. These repair mechanisms work extremely well, but they are not perfect. The greater the exposure to a mutagen (such as UV light), the more likely that a mistake will not be corrected.

63. Cowabunga!!!