2. DNA and RNA Chapter 12

3. DNA was not isolated from cells until the 1800s 1929 – 3 major components were identified 1940s – base pairs occur in equal amounts 1953 – structure discovered

4. Rosalind Franklin & Maurice Wilkins –X-ray crystallographic images of DNA James Watson, Francis Crick –Used x-ray crystallography images & models to figure out double helix structure Important Scientists in the Discovery Of DNA

5. Basic Structure Chains of nucleotides (base, sugar, and phosphate)

6. Basic Structure Double helix, 2 strands of anti- parallel DNA nucleotides Ladder-like –Sugar and P on outside (sides of ladder) –Bases on inside (rungs of ladder) Base pairing- –Always A/T, G/C –H bonds between bases Entire molecule twisted in helix shape

8. 5’ 3’ 5’ 3’

9. Chromosomes and DNA Replication

10. DNA and Chromosomes DNA is found in form of chromosomes –The nucleus in eukaryotic cells –Free floating in prokaryotic cells The number of chromosomes varies between species

13. 12 DNA by the Numbers Each cell has about 2 m of DNA. The average human has 75 trillion cells. The average human has enough DNA to go from the earth to the sun more than 400 times. DNA has a diameter of only 0.000000002 m. The earth is 150 billion m or 93 million miles from the sun.

14. DNA Replication

15. When would we need to replication DNA?

16. DNA replication is semi- conservative The instructions For making each new strand Are contained in the old, Parent strand!!! http://www.lewport.wnyric.org/JWANAMAKER/animations/DNA%20Replication%20-%20long%20.html

17. Origin of replication-where DNA synthesis starts Helicase first binds here

18. Steps in DNA synthesis…. 1.Helicase unzips helix at origin of rep., forming replication fork 2.DNA polymerase reads bases on leading strand, places complementary nucleotides in place as it moves toward rep. fork 3.On lagging strand, DNA polymerase builds new strand in small fragments- DNA ligase joins them together 4.This continues until the ends of the parent strands are reached

19. Why can’t the lagging strand be built continuously? The replication fork continues to grow and…. DNA polymerase can’t go “backwards”

20. DNA repair DNA polymerase proofreads its work as it goes along & fixes most mistakes!!!!

22. RNA and Protein Synthesis

23. The Structure of RNA

24. 3 types of RNA transfer RNA (tRNA) – carries amino acids to help build proteins contains an anti-codon (3 base complimentary to mRNA)

25. 3 types of RNA ribosomal RNA(rRNA) – rRNA and protein make the ribosome

26. Messenger RNA (mRNA)- copy of DNA made in the nucleus

27. DNA vs RNA DNA Double stranded BASES: ATCG Sugar: deoxyribose RNA Single stranded BASES: AUCG Sugar: Ribose

28. Transcription

29. Transcription Essentials occurs in nucleus. production of mRNA copy of the DNA gene.

30. Steps of Transcription 1.Initiation: DNA is unzipped and the enzyme RNA polymerase runs along the template strand of the DNA. 2.Elongation: As the RNA polymerase runs along the DNA template strand it will add the complementary RNA nucleotides to the DNA nucleotides. 3.Termination: Transcription continues until RNA polymerase reaches a DNA region called the nucleotide sequence that marks the end of a gene. RNA polymerase releases the DNA and new RNA molecule. The DNA will re-zip into the double helix.

31. The Process of Transcription

32. Diagrams of Transcription

33. Transcription animation

34. The Genetic Code Proteins are made by joining amino acids together forming long chains called polypeptides –The type of protein is determined by the order of amino acids How is the “recipe” found in DNA which becomes the “language” of mRNA translated into a protein????

35. “language” of mRNA instructions are found in the genetic code Read three letters long – codon

36. Amino Acid Chart

38. Translation

39. The Process of Translation Protein Synthesis: Translation

40. Translation Translation occurs when the mRNA strand moves out of the nucleus and into the cytoplasm to a ribosome. –At this point mRNA, rRNA and tRNA all come together. The rRNA consists of two parts, the large ribosomal unit and the small ribosomal unit. –The rRNA is like the factory of translation and tRNA is the worker.

41. Terminology for Translation The tRNA molecules have an amino acid attachment site and carries an anticodon. Anticodon: the 3 nucleotide sequence on t-RNA –picks up the appropriate amino acid in the cytoplasm that is coded for by the mRNA codon

42. General Steps of Translation Initiation: tRNA is bonded to mRNA, rRNA polymerase binds to mRNA strand. Elongation: Ribosome reads mRNA chain in three nucleotide groups (codon) & inserts another tRNA. –tRNA binds to mRNA codon. Translocation: the ribosomal unit physically moves (translocates) 3 bases (a new codon: AUG) along the mRNA in the 5' ---> 3' direction. Termination: tRNA recognizes release factors of nonsense codon. Newly completed polypeptide is released from ribosome.

43. animation

44. Let’s make a protein 1.Transcribe DNA to mRNA AATTGG CGATTTCGA

45. Let’s make a protein 1.Transcribe DNA to mRNA AAT TGG CGATTTCGA UUA ACC GCU AAA GCA 2. Now use the codon chart or wheel to determine the order of amino acids

46. Let’s make a protein 2. Now use the codon chart or wheel to determine the order of amino acids UUA ACC GCU AAA GCA

47. Let’s make a protein 2. Now use the codon chart or wheel to determine the order of amino acids Leucine Threonine Alanine asparic Acid You can abbreviate the amino acids with the first three letters of each Leu Thr Ala Asp

48. Gene regulation and Mutations

49. Mutations Any change in DNA sequence is called a mutation. –Mutations can be caused by errors in replication, transcription, cell division, or by external agents. If mutation occurs in gametes (sex cells) it will be passed on to offspring –A mutation may produce no change, a new trait, or it may result in a protein that does not work correctly. –If the mutation results in a protein that is nonfunctional, and the embryo may not survive. –In some rare cases a gene mutation may have positive effects.

50. Mutations If mutation takes place in a somatic cell, it is not passed on to organism’s offspring –Damage to a gene may impair the function of the cell –When that cell divides, the new cells also will have the same mutation –Some mutations of DNA in body cells affect genes that control cell division. –This can result in the cells growing and dividing rapidly, producing cancer.

51. Characteristics of Mutations One of the main sources of genetic variation. – Unique traits are thought to originate through mutations that are passed on Occur a random sometimes a mistake in base pairing during DNA replication. many mutations are caused by factors in the environment Can be classified as either: – Gene Mutations – Chromosomal Mutations (we will talk about this later)

52. Gene Mutations Changes that affect the nucleotide sequence of a gene –change the DNA –changes the mRNA –may change protein –may change trait DNA TACGCACATTTACGTACG mRNA AUGCGUGUAAAUGCAUGC aa protein trait

53. Types of gene mutations

54. Point Mutations Involves changes in one or a few nucleotides –may cause change to protein, may not THEFATCATANDTHEREDRATRAN THEFATCARANDTHEREDRATRAN THEFATCATENDTHEREDRATRAN OR

55. Types of Point Mutations Substitution mutation = one base is changed for another AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUAUGCGAGUGA MetArgValTyrValCysGluStop

56. Sickle cell anemia- a single substitution Hemoglobin protein in red blood cells –strikes 1 out of 400 African Americans –limits activity, painful & may die young

57. Insertion = add one or more bases- AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUCAUGCGAGUGA MetArgValTyrValMetArgValA

58. Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGAUGCGAGUGA MetArgValTyrAspAlaSerGA

59. Frameshift Mutations Add or delete one or more bases –changes the meaning of the whole protein as it changes how the mRNA codons are read. This change causes all remaining codons to be incorrectly grouped. The change in “reading frame” causes all resulting proteins to be made improperly. –Deletions and insertions cause frameshifts THEFATCATANDTHEREDRATRAN THEFATCANTANDTHEREDRATRAN THEFATCAANDTHEREDRATRAN OR

60. Gene Regulation

61. Most of our genes are not expressed all the time How does your cell know what to express? need of the organism or specific cells Genes are turned “on” or “off” using regulatory sequences More complex in eukaryotic genes than in prokaryotic genes