1. Genetic variation is a difference in DNA tic variation is a difference in DNA

2. How different is one human genome from another? The more closely related two people are, the more similar their genomes. Scientists estimate that the genomes of non-related people differ at about 1 in every 1,200 to 1,500 DNA bases There are more than three million differences between your genome and anyone else's. On the other hand, we are all 99.9 percent the same, DNA- wise. Most genome variations are relatively small and simple involving only a few bases If the genome were a book, every person's book would contain the same paragraphs and chapters, arranged in the same order. Each book would tell more or less the same story. But my book might contain a typo on page 303 that yours lacks, and your book might use a British spelling on page 135—"colour"—where mine uses the American spelling—"color." http://www.genomenewsnetwork.org/resources/whats_a_genome/Chp4_1.shtml

3. If every human genome is different, what does it mean to sequence "the" human genome? The complete human genome sequence announced in June 2000 is a "representative" genome sequence based on the DNA of just a few individuals. The scientific paper was published in the February 16, 2001 issue of Science. http://www.genomenewsnetwork.org/resources/whats_a_genome/Chp4_1.shtml

4. If every human genome is different, what does it mean to sequence "the" human genome? Over the longer term, scientists will study DNA from many different people to identify where and what variations between individual genomes exist. Sequencing a genome is such a Herculean task that capturing its person-to-person variability on the first pass would be next to impossible. The vast majority of the genome's sequence is the same from one person to the next, with the same genes in the same places. In other words, my genome is a pretty good approximation of yours, and if scientists sequenced your genome they would learn a lot about mine. http://www.genomenewsnetwork.org/resources/whats_a_genome/Chp4_1.shtml

5. Where are genome variations found? Variations are found all throughout the genome, on every one of the 46 human chromosomes. But this variation is not distributed evenly: It's not as if there is one difference every 1,000 bases as regular as rain. Instead, some parts of the genome are has hundreds of possible variations of a sequence. Other parts of the genome, don't vary much at all between individuals—in scientific parlance, they are said to be "stable." http://www.genomenewsnetwork.org/resources/whats_a_genome/Chp4_1.shtml

6. Where are genome variations found? The majority of variations are found outside of genes, in the "extra" or "junk" DNA that does not affect a person's characteristics. Mutations in these parts of the genome are never harmful, so variations can accumulate without causing any problems. Genes, by contrast, tend to be stable because mutations that occur in genes are often harmful to an individual, and thus less likely to be passed on. http://www.genomenewsnetwork.org/resources/whats_a_genome/Chp4_1.shtml

7. What kinds of genome variations are there? Genome variations include 1- mutations 2- polymorphisms. Technically, a polymorphism is a DNA variation in which each possible sequence is present in at least 1 percent of people. For example, a place in the genome where 93 percent of people have a T and the remaining 7 percent have an A is a polymorphism. If one of the possible sequences is present in less than 1 percent of people (99.9 percent of people have a G and 0.1 percent have a C), then the variation is called a mutation. http://www.genomenewsnetwork.org/resources/whats_a_genome/Chp4_1.shtml

9. Mutation http://www.genomenewsnetwork.org/resources/whats_a_genome/Chp4_1.shtml

10. Mutation vrs polymorphism Informally, the term mutation is often used to refer to a harmful genome variation that is associated with a specific human disease, while the word polymorphism implies a variation that is neither harmful nor beneficial. However, scientists are now learning that many polymorphisms actually do affect a person's characteristics, though in more complex and sometimes unexpected ways.

11. Single-nucleotide polymorphisms SNPs The occasional single-letter differences that distinguish DNA among people are called single-nucleotide polymorphisms (SNPs). SNP is a source variance in a genome. A SNP is a single base mutation in DNA. SNPs are the most simple form and most common source of genetic polymorphism in the human genome (90% of all human DNA polymorphisms). A polymorphism is a genetic variant that appears in at least 1% of a population

12. SNPs. Any one of the four DNA bases may be substituted for any other—an A instead of a T, a T instead of a C, a G instead of an A, and so on. Theoretically, a SNP could have four possible forms, or alleles, since there are four types of bases in DNA. But in reality, most SNPs have only two alleles. For example, if some people have a T at a certain place in their genome while everyone else has a G, that place in the genome is a SNP with a T allele and a G allele. The human genome contains more than 2 million SNPs.

13. Genetic variation is the genetic variety of humans and represents the total amount of genetic characteristics observed within the human species. Genetic differences are observed between humans at both the individual and the population level. There may be multiple variants of any given gene in the human population (alleles), leading to polymorphism. http://en.wikipedia.org/wiki/Human_genetic_variation alleles : is one of two or more forms of the DNA sequence of a particular gene

14. Allele An allele is an alternative form of a gene (one member of a pair) that is located at a specific position on a specific chromosome.

15. Genetic variation No two humans are genetically identical. Even monozygotic twins, who develop from one zygote, have infrequent genetic differences due to mutations occurring during development and gene copy number variation has been observed Differences between individuals, even closely related individuals, are the key to techniques such as genetic fingerprinting. http://en.wikipedia.org/wiki/Human_genetic_variation

16. A schematic of worldwide human genetic variation, with colors representing different genetic types. The figure illustrates the great amout of genetic variation in Africa. Illustration by Martin Soave/University of Michigan

20. Does everybody have the same number of genes? Usually, but not always. A key type of genetic variation is “copy number” variation, which has been observed in identical twins that otherwise have identical DNA. Typically, everyone has two copies of each gene, one inherited from each parent.

22. Genetic variation Are there other types of genetic variation? Yes. Another type of genetic variation that goes beyond differences in DNA sequence is epigenetics. This type of variation arises from chemical tags that attach to DNA and affect how it gets read. The chemical tags, called epigenetic markings, act as switches that control how genes can be read. epigenetics is the study of inherited changes in phenotype (appearance) or gene expression caused by mechanisms other than changes in the underlying DNA sequence, hence the name epi- (Greek: επί- over, above) -genetics.

23. Is genetic variation related to health and disease? Yes. Minor differences in DNA sequence have an effect on health and disease risk. Because parents pass on their genes to offspring, some diseases tend to cluster in families, similar to other inherited traits such as some aspects of physical appearance. In addition, epigenetic markings have been associated with some types of disease, such as cancer.

24. Haplotype What is a haplotype? Just as a SNP is a single-nucleotide change, a haplotype is a set of genetic changes-- usually a group of SNPs that tend to be inherited together. Think of a haplotype as a “gene neighbourhood.” Haplotype (haploid genotype) A particular pattern of sequential SNPs found on a single chromosome. These SNPs tend to be inherited together over time and can serve as disease- gene markers.

25. Genetic Polymorphism A difference in DNA sequence among individuals, groups, or populations. Sources include SNPs, sequence repeats, insertions, deletions and recombination. (e.g.a genetic polymorphism might give rise to blue eyes versus brown eyes, or straight hair versus curly hair). Genetic polymorphisms may be the result of chance processes, or may have been induced by external agents (such as viruses or radiation). http://www.cs.mcgill.ca/~kaleigh/compbio/snp/snp_summary.pdf

26. Genetic Mutation Every human genome is different because of mutations— "mistakes" that occur occasionally in a DNA sequence. When a cell divides in two, it makes a copy of its genome, then parcels out one copy to each of the two new cells. Theoretically, the entire genome sequence is copied exactly, but in practice a wrong base is incorporated into the DNA sequence every once in a while, or a base or two might be left out or added. These mistakes—"changes" might be a more accurate word, because they are not always bad news—are called mutations. http://www.genomenewsnetwork.org/resources/whats_a_genome/Chp4_1.shtml

27. Genetic Mutation If a difference in DNA sequence among individuals has been shown to be associated with disease, it will usually be called a genetic mutation. Changes in DNA sequence which have been confirmed to be caused by external agents are also generally called "mutations" rather than "polymorphisms

28. Genetic Mutation Genetic Mutation A change in the nucleotide sequence of a DNA molecule. Genetic mutations are a kind of genetic polymorphism. The term "mutation," as opposed to "polymorphism," is generally used to refer to changes in DNA sequence which are not present in most individuals of a species and either have been associated with disease (or risk of disease) or have resulted from damage indicted by external agents (such as viruses or radiation).

29. GATACAATGCATCATA GATGCAATGTATCATA

30. Mutation Vs polymorphism a mutation: is induced from outside the cell: by an exogenous factor, is inheritable and will not necessarily be harmful to the host. Therefore a mutation is individualised and will occur in less than 1% of the population. A polymorphism: is induced from within the cell is heritable but is not necessarily harmful to the host. This heritable change will occur in at least 1% of the population.

31. Gene CTGCTTGTCAAAAGGCGGCAGCGGAGCCGTGTGCGCCGGGAGCGCGGAACAGCTTGTCCACCCGCCGGCC GGACCAGGTGCGAACCCGGGAGCAGCGGGAAAGGGGGTCTCAGGATAGGGACTCGGGGTCGGGGCGTCTG GGATACCGGGGCCTGAGCGCCCGGCTGCGAGCATTAGAGTCTAAGTCTCAGCGGTAAACTTGGCTACTGA GGTCCGGGCTGTCGTGCCATGAGGCTGGGACACTAAGGGGCACTGAGGTTTGAGAAAGCTGAAGTTCGTG CCAGGCTGGCGAGGGGAGCAGCGACATCCTCGGCGCTTAGGAGAAATGCTCCGCTAACACAGTGCTTAGC ACTTGGGCAACAAGAAGTATTTGTTTCCTTCTTCTGTCGGGGCGCCTTGGCATGGAGTGGAGGAATAAGA AAAGGAGCGATTGGCTGTCGATGGTGCTCAGAACTGCTGGAGTGGAGGGTGTGTAACCTTATTTATTGTC TTACAGGGCCCAGGTATGGTCACCTGTGATGGTGGAGTTGGGTCTTTTAAGTAATTTTTTTTTTTTTTTT TTTTTTTTTACTTTTCTTTGAACTACCAATGAGTTTAGACCTAATTGGCCCTATTTTTTTTCAGGACAGC CTGTCAATAGATGTTCAGAGGAACTCAGGGGCAAGCATTTAAATGAGGAAGGGGCTCAAGGAGTAGTTTC TGTTTGAAAAGTGAGGTGCCCTGGATCTGTGGGTGGTGGTGAGGAAGATTCAGAAGTATCTAGGAGGGAA CAGCCTGTGGTCTCCAGGGCCAGTGTACAACTGCCCCTCCTTCTCTTCACCCAGGGACCAGAGTCTGAGA CCTAGCCTGGGCTGGGGGAGCCTTAGGTCTCCAAGCCCAGACCCTTCTCACAGTTCCTCCTCCTTCTCCT CCTCCTCCTCCTCCTCCTCCTCTTGTTCCTCCTCCTCCTCTATGCGTGCGGTGAGTGAGTCAGCCTCCTG TCTGGGCTCAGTTGCAGCCAAAGGGGCCAGAGCCCAGGCAAGCAGTTGGGCAGGCATTTTCTGAGCATTG CAGAAGCTCTCCTGGGCAGAGTTCAGCTCTGCTCCAGCTCCCTGCTGGAAGGTGGTCTTCCTCATGGGCA GGGGCTCAGATACCCAACACAGCAGTGCTTATGGAATGGCTATGAGATGATTCTAGCAGGAGGTGACCGT GAAGGGATAGTGGCTTTATGATAAATCTACATCTCATCTTTCTCCTGGGATAAGGAGGTGCATCCCAGCA CTGCAGGCTTTTCCAGCCCTTCCTTCCATTTCTGCCTAGTGGTCTCATTAGCAGCCCATCTCTGCTAGTG AAGGGGGTGAGCAAAAGAAATTAGGAAAGTCTGGGGCCAGAGAAGTCATGGTGTTGGCAAAGAAGGCTTT AACTCAGGCTAGGGAGTGAGGGTGATTTGCTGAGGTAGAAATGGGTTATCTGAACATTGGAGCCTCAATT CTATGGACTAAGAGTGTTGTGTGTTGAGAGACCTGCCGTCCCTTCCCTGTCCAAGTGCTGGAGGGAACTG TGAGTCTTTCTGAAACAGTCTCAGGGCTGGCATGCAGCCAGACCAGAAGGTAGTAAGACTGCACATTTCT CCCTGGCTTTTGTTTTGGGTGCTAGAGATCGTTGAACAGAAGTAGCCCTCCCTGCAGAGTCCGTGGCCCC CACTCAGCAGCCTCTCTGGACCTATTTGAGAAGAGTCCTGGGAGGCCAATCCAGCTGTGGGGCTGACTCA AACTGCAAAAAGCTGGGGAATTCACAGTCTATGCTCTGGCTGGGTCCCATGGCTTTGGGTTTGGCTGGTC TTGATCAGCTGTGACTTGGACCCTTACCAAGCTAAAGGAGGGACTAGAAAATGGGGTAAGAAAGGAGGGG AAAAAATGAGAGTTAGAAAGCCTTCCCAACCCTTTACTCCTCTTCGGCAGAGGCCATCAGACTTTGTTTG TATAAACATTATGGAAGGTCGGGTGCTGTTTGGGGTGCCCTGATAGTTTGTGTTTATGGTTTCTCAGTAT

32. snp

33. http://www.riken.go.jp/engn/r-world/info/release/news/2003/nov/index.html

34. http://www.rikenresearch.riken.jp/eng/frontline/5222

35. http://www.cdc.gov/ncidod/eid/vol3no4/beard.htm

36. Soad: AACACGCCA TTCGGGGTC Samar: AACACGCCA TTCGAGGTC Ahmed: AACATGCCA TTCGGGGTC Adel: AACACGCCA TTCGGGGTC

37. http://www.cdc.gov/ncidod/eid/vol3no4/beard.htm http://www.rikenresearch.riken.jp/eng/frontline/5222 http://www.riken.go.jp/engn/r-world/info/release/news/2003/nov/index.html http://www.genomenewsnetwork.org/resources/whats_a_genome/Chp4_1.shtml http://www.cs.mcgill.ca/~kaleigh/compbio/snp/snp_summary.pdf http://en.wikipedia.org/wiki/Human_genetic_variation alleles : is one of two or more forms of the DNA sequence of a particular gene http://www.genomenewsnetwork.org/resources/whats_a_genome/Chp4_1.shtml