1. DNA TECHNOLOGY CHAPTER 13 LAB BIOLOGY CHAPTER 13 HONORS BIOLOGY

2. DNA TECHNOLOGY DNA Technology – science involved in the ability to manipulate genes/DNA Purpose:  Cure disease (Cystic Fibrosis)  Treat genetic disorders (Hemophilia, diabetes)  Improve food crops (better tasting, longer shelf life, fungus resistance…)  Improve human life in general  Helps us ID genes for traits

3. I. How could you get a desired trait without directly manipulating the organisms’ DNA? A. Selective Breeding - choosing organisms with desired traits to produce the next generation Breeding the winners of a horse race (Smarty Jones) Taking the seeds from the Great Pumpkin

4. B. HYBRIDIZATION Crossing organisms with different traits to produce a hardier product Ex. A mule is a cross of a horse and a donkey – Sturdy and surefooted Hybrid corn – tastes good and is more resistant to disease.

5. C. INBREEDING Maintaining the present genes by breeding only within the population Ex. Pedigree animals Risk with dipping into the same gene pool and recessive traits showing up that may be lethal or harmful.

6. D. INDUCING MUTATIONS By using known mutagens, attempt to force mutations to occur Radiation & Chemicals Not a sure bet nor do you know what you are going to get Polyploidy (3N or 4N) plants have resulted from this – larger & hardier

7. II. Manipulating Genes by Altering an Organisms DNA DNA Technology Purpose Cure Diseases Treat Genetic Disorder Improve Food Crop Improve Human Life (reproduce desired traits)

8. III. Practical Uses of DNA Technology (positive) Pharmacutical Products Genetically Engineered Vaccine Increasing Agricultural Yields (negative) Allergies GMO (genetically Modified Organisms) Supperweeds

9. Cloning Growing a population of genetically identical cells from a single cell Let’s discuss the positives and negatives of m cloning….. Let’s do a little research first…… Lab Bio: Read Pros and Cons of Cloning Honors Bio: Read The Real Face of Cloning

10. DNA TECHNOLOGY: EX: GENE THERAPY Treatment of a genetic disorder (like cystic fibrous) by correcting a defective gene that causes a deficiency of an enzyme. Nasal spray that carries normal enzyme gene. Body makes enzyme and patient breathes normally. Regular treatments necessary Has not been proven to be successful in the long term

11. How do we copy a piece of DNA….. The Tools: DNA Extraction – Chemical procedure (we’ll do this) Restriction enzymes Restriction enzymes – molecular scissors that cut DNA at specific nucleotide sequences Gel Electrophoresis Gel Electrophoresis – method to analyze fragments of DNA cut by restriction enzymes through a gel made of agarose (molecular sieve) DNA Ligase – molecular glue that puts pieces of DNA together Polymerase Chain Reaction (PCR)- molecular copy machine. Makes millions of copies of DNA/hr

12. Let’s suppose that you are a diabetic and can not make your own insulin. What are you to do? Inject insulin of course but from what source? Old method was to use sheep insulin. Costly and labor intensive New method: Let bacteria with a human insulin producing gene make it for you

13. THE METHOD: Transformation of a bacterium to produce human insulin 1.Extract the insulin producing gene from a healthy human 2. Using a restriction enzyme, cut the insulin producing gene out of a the DNA

14. WHAT ARE RESTRICTION ENZYMES? Bacterial enzymes – used to cut bacteriophage DNA (viruses that invade bacteria). Different bacterial strains express different restriction enzymes Restriction enzymes recognize a specific short nucleotide sequence For example, Eco RI recognizes the sequence:  5’ - G A A T T C - 3’  3’ - C T T A A G - 5’  Pandindrones same base pairing forward and backwards

16. Let’s try some cutting: Using this piece of DNA, cut it with Eco RI  G/AATTC GACCGAATTCAGTTAATTCGAATTC CTGGCTTAAGTCAATTAAGCTTAAG GACCG/AATTCAGTTAATTCG/AATTC CTGGCTTAA/GTCAATTAAGCTTAA/G

17. WHAT RESULTS IS: GACCG AATTCAGTTAATTCG AATTC CTGGCTTAA GTCAATTAAGCTTAA G Sticky end Sticky end - tails of DNA – easily bind to other DNA strands

18. BLUNT & STICKY ENDS Sticky ends – Creates an overhang. EcoRI Blunts- Enzymes that cut at precisely opposite sites without overhangs. SmaI is an example of an enzyme that generates blunt ends

19. CLONING VECTORS Cloning vector is a carrier that is used to clone a gene and transfer it from one organism to another. Many bacteria contain a cloning vector called a PLASMID. PLASMID  is a ring of DNA found in a bacterium in addition to its main chromosome

20. 3. CUT CLONING VECTOR: Use bacterial plasmids  Plasmids will be cut with the same restriction enzyme used to cut the desired gene

21. 4. Ligation - Donor gene (desired gene) is then spliced or annealed into the plasmid using DNA ligase as the glue. Recombinant DNA - DNA with new piece of genetic information on it 5. Plasmid is then returned to bacterium and reproduces with donor gene in it. Transgenic organism – organism with foreign DNA incorporated in its genome (genes) 6. Bacterium reproduces and starts producing human insulin gene which we harvest from them.

22. Recombinant DNA Donor Gene

24. EXPRESSION OF CLONED GENES Sometimes PROMOTERS must also be transferred so the genes will be turned on. Genes are often turned off until the proteins they code for are needed.

25. HOW CAN YOU GET A DESIRED TRAIT WITHOUT DIRECTLY MANIPULATING THE ORGANISMS DNA? 1.HYBRIDIZATION; crossing organisms of different traits to produce a hardier product ex: mule 2.INBREEDING/SELECTIVE BREEDING; maintain the present genes by breeding only within the population ex: pedigree animals 3.INDUCING MUTATIONS; radiation, chemicals  polyploidy (3N or 4N) plants resulted  larger and hardier

26. NOW LET US MANIPULATE THE GENES BY ALTERING THE ORGANISMS DNA a)DNA Technology: sci. involved in the ability to manipulate genes/DNA a)Cure disease b)treat genetic disorders c)Improve crops

27. TOOLS: 1.DNA extraction 2.Restriction enzymes 3.Gel electrophoresis 4.DNA ligase 5.Polymerase chain rxn. (PCR)

28. METHOD: (5 STEPS) 1.Extract gene  insulin 2.Cut insulin producing gene out using “restriction enzymes” 1.Sticky ends  create overhang 2.Blunts  no overhangs 3.Cutting clone vector  cut plasmid with same restriction enzyme 4.Ligation: donor gene is spliced into plasmid DNA, DNA ligase glues it (this forms recombinant DNA = plasmid DNA + new piece of DNA) 5.Plasmid returned to bacterium & reproduces using donor gene in it (this is transgenic organism = organism with foreign DNA incorporated in it’s genome) 6.*reproduce*

29. RESTRICTION ENZYMES BACTERIAL ENZYMES are used to cut DNA molecule into more manageable pieces They recognize certain sequences Creating “ single-chain ” tails in DNA  called STICKY ENDS

30. STICKY ENDS Readily bind to complimentary chains of DNA therefore pieces of DNA that have been cut with the same restriction enzyme can bind together to form a new sequence of nucleotides Recognizes  CTTAAG

31. *

32. *

33. CLONING VECTORS Cloning vector is a carrier that is used to clone a gene and transfer it from one organism to another. Many bacteria contain a cloning vector called a PLASMID. PLASMID  is a ring of DNA found in a bacterium in addition to its main chromosome.

34. PROCEDURE To be used as a cloning vector in gene transfer experiments a plasmid is isolated from a bacterium. Using restriction enzymes the plasmid is then cut and a DONOR GENE (specific gene isolated from another organism is spliced into it) Then the plasmid is returned to the bacterium, where it is replicated as the bacterium divides, making copies of the donor gene. Plasmid now contains a GENE CLONE

35. *

36. CLONING VECTORS !

37. PLASMID *

38. TRANSPLANTING GENES In some cases, plasmids are used to transfer a gene to bacteria so that the bacteria will produce a specific protein  Ex: INSULIN = protein that controls sugar metabolism  Bacteria that receives the gene for insulin will produce insulin as long as the gene is not turned off

39. STEPS: 1. ISOLATING A GENE – isolate the DNA from human cells and plasmids from the bacteria  Use restriction enzyme  Splice human DNA into plasmids to create a genomic library (set of thousands of DNA pieces from a genome that have been inserted into a cloning vector)

40. Steps cont… 2. PRODUCING RECOMBINANT DNA = combination of DNA from 2 or more sources  Inserting a donor gene such as human gene for insulin, into a cloning vector, such as bacterial plasmid results in a recombinant DNA molecule!

41. Steps cont… 3. CLONING DNA – the plasmid containing recomb. DNA is inserted into a host bacterium (called transgenic organism  The trans. Bact. Is placed in a nutrient medium where it can grow and reproduce.

42. *

43. *

44. EXPRESSION OF CLONED GENES Sometimes PROMOTERS must also be transferred so the genes will be turned on. Genes are often turned off until the proteins they code for are needed.

45. PRACTICAL USES OF DNA TECHNOLOGY 1.Pharmaceutical products: insulin, HBCF (human blood clotting factor) 2.Genetically engineered vaccines 3.Increased agriculteral yields 4.Improving quality of produce 1.Slow down ripening 2.Enhance color 3.Reduce fuzz 4.Increase flavor 5.Frost resistance

46. NEGATIVES Allergies Label’s don’t include all information May create “super weeds”

47. GENE THERAPY Treatment of genetic disorders Ex: cystic fibrosis

48. DNA TECHNOLOGY TECHNIQUES I. DNA Fingerprints  pattern of bands made up of specific fragments from an individual ’ s DNA USED FOR:  DETECTION OF A RELATIVE  SIMILARITIES BETWEEN SPECIES

49. HOW DO YOU MAKE DNA FINGERPRINTS? RFLP (restriction fragment length polymorphism) analysis  1. extract DNA from specimen using restriction enzymes  2. separate fragments of DNA using electrophoresis (separates DNA according to size and charge)  3. placed in wells made on gel and run electric current through gel  4. blotted onto filter paper/ photgraphic film.

50. HOW DO YOU MAKE DNA FINGERPRINTS? RFLP (restriction fragment length polymorphism) analysis  1. extract DNA from specimen using restriction enzymes  2. separate fragments of DNA using electrophoresis (separates DNA according to size and charge)  3. placed in wells made on gel  4. electric current run through gel

51. Continue…  5. negative fragments migrate to positive charged end of gel but not all at same rate  6. pores in gel allow smaller fragments to migrate faster  separating fragments by size.  7. blotted onto filter paper.

52. CAN YOU TELL IF THIS COULD BE THE FATHER?

53. ACCURACY OF DNA FINGERPRINTS DNA fingerprints are very accurate However, genetic tests can only absolutely disprove, not prove, relationship! Courts accept 99.5% accuracy as proof of alleged paternity

54. POLYMERASE CHAIN REACTION (PCR) Used when you only have a TINY piece of DNA PCR can be used to quickly make many copies of selected segments of the available DNA Use a PRIMER to initiate replication DNA doubles every 5 minutes

55. PCR IS USED FOR: 1. crimes 2. diagnosing genetic disorders from embryonic cells 3. studying ancient fragments of DNA (tiny amounts)

56. HUMAN GENOME PROJECT 2 GOALS: 1. determine nucleotide sequence of entire human genome (aprox 3 billion nucleotide pairs or about 100,000 genes 2. map the location of every gene on each chromosome

57. 1996 1 % of 3 billion nucleotide pairs of DNA human genomes were analyzed This allows for us to identify and determine the function of 16,000 genes!

58. GENE THERAPY Treating a genetic disorder by introducing a gene into a cell or by correcting a gene defect in a cell ’ s genome. Ex: Cyctic fibrosis  cause one defective gene  malfunction of one protein

59. GENE THERAPY FOR CYCTIC FIBROSIS Nasal spray carrying normal cyctic fibrosis gene to cells in nose and lungs Must repeat treatment periodically

60. ETHICAL ISSUES Many people worry about how personal genetic information will be used:  Insurance???  Employment????  Human Genome Project will undoubtedly involve ethical decisions about how society should use the information! WHAT DO YOU THINK??

61. PRACTICAL USES OF DNA TECHNOLOGY 1. produce perscription drugs  Vaccine (harmless version of a virus or a bacterium)  Pathogen (disease causing agent) treated chemically or physically so that they can no longer cause disease.  Pathogen (Ag)  Antibody (Ab)  DNA tech. may produce vaccines safer than traditional ones!

62. INCREASING AGRICULTURAL YIELDS DNA Tech.  used to develop new strains of plants Ex: scientists can make tomato plants toxic to hornworms and effectively protect the plant from these pests.

63. SEE THE HORNWORM BEGINNING TO FORM AT THE LEAVES !

64. THIS HORNWORM EATS AND DESTROYS THE TOMATO PLANT!

65. HORNWORMS ATTACK TOMATO PLANTS

66. CROPS THAT DO NOT NEED FERTILIZER Plants require NITROGEN to make proteins and nucleic acids Most plants get their N from the soil TRANSGENIC FOOD CROPS  contain genes for nitrogen fixation so they can grow in nitrogen POOR soil.

67. GENETICALLY ENGINEERED FOODS Foods may have toxic proteins or substances  causing ALLERGIES Ex: changing the gene that codes for an enzyme to ripening in tomatoes they are able to make tomatoes ripen without becoming SOFT!!

68. GENETICALLY ENGINEERED CROPS Some are concerned that genetically engineered crops could spread into the wild and wipe out native plant species. SUPERWEEDS!!!!!!!!