1. Chromosomal Patterns of Inheritance

2. One gene, many traits From Wiki: A classic example of pleiotropy is the human disease PKU (phenylketonuria). This disease can cause mental retardation and reduced hair and skin pigmentation, and can be caused by any of a large number of mutations in a single gene that codes for an enzyme (phenylalanine hydroxylase) that converts the amino acid phenylalanine to tyrosine, another amino acid. PKU is totally benign if a diet free from phenylalanine is maintained. Depending on the mutation involved, this results in reduced or zero conversion of phenylalanine to tyrosine, and phenylalanine concentrations increase to toxic levels, causing damage at several locations in the body.phenylketonuriamental retardationhairskinpigmentation enzymephenylalanine hydroxylaseamino acid phenylalaninetyrosine

3. From your syllabus http://en.wikipedia.org/wiki/Labrador_Retriever_co at_colour_genetics

4. Autosomes Sex Chromosomes Chromosomes 1-22Chromosomes X, Y

5. P: AABB x aabb Gametes: AB, ab F1: AaBb Gametes: AB, Ab, aB, ab F2: AABB, AABb, AAbb, AaBB, AaBb, Aabb, aaBB, aaBb, aabb What does this correlate to in the real world? A single letter corresponds to a particular trait of interest. To distinguish between different ‘flavors’ of the trait, we use differing letters (capital vs. lowercase). Height: T and t, because there are only two possible flavors of height in our previous examples: Tall and Short. What if there was more than one allele? We couldn’t use simply capital and lowercase letters. Perhaps T1, T2, T3? The nomenclature is not important – what is important is the fact that we are representing real-world phenomenon with arbitrary ‘placeholders’.

6. AABB AA BB A is the name we give to a trait of interest. How does a trait get determined? By a gene. So A also represents a gene. A gene is just a sequence of DNA along a chromosome. So A also represents a sequence of DNA. When our sequences differ in genes (which they do), we call each version of the sequence an allele. So A represents an allele, too. We distinguish between different alleles by changing something about the representing letter. If there are only 2 alleles for the gene (like mendel’s traits), then we can simply use capital and lowercase letters.

7. But remember that A (or a, or Y, or X R or R 1 ) all of these ultimately represent a sequence of DNA! Sometimes, we’re interested in a sequence of DNA that is longer than just 1 gene. Sequences of DNA that encompass multiple genes are called genetic loci, or just loci. And keep in mind that a chromosome is simply one huge long stretch of single- stranded DNA. So any level of DNA can potentially be of interest to a genetics situation, including chromosomes. Aa (a gene) R S (a locus) (a chromosome) ATCCGATTCGATCGAGCTACG (a sequence)

8. When we’re concerned with the movement of entire chromosomes from parents to offspring, we can represent them the same way we represent genes - with a single letter. X chromosome Y chromosome XY = male XX = female We care about genes on the X chromosome, because males only have a single copy of them (a single factor / allele), while females have 2. These leads to interesting genetics phenomena. XX XY It should be noted that very few genes reside on the Y chromosome.

9. We call traits associated with genes on the X and Y chromosomes “Sex-Linked”. Because the X chromosome is bigger (and therefore has many more genes than the Y chromosome), many of the sex-linked genes we learn about are located on the X chromosome. We therefore call these “X-Linked” genes (which of course have associated “X-linked” alleles) Here, notice that males have only a single allele for the gene pointed out in red. For mom, it’s just like any other gene; she can be dominant or recessive. But Dad is different – he has only a single allele for the gene. XX XY

10. That means if dad has a recessive allele, he will express its phenotype; there is no compensating dominant allele. So dad can never be a carrier. He either has the X-linked trait, or he doesn’t. As an example, we’ll use fruit flies. R = red eyes r = white eyes Because we know the gene for eye color is on the X chromosome, we use the following notation: X R, X r Let’s do a few of these crosses on the marker board. YX R X R X R

11. Color blindness Muscular Dystrophy Hemophilia Fragile X Syndrome

12. Two-trait crosses gave unexpected results that deviated from Mendels laws – traits would actually ‘travel’ together as a group. This was called a “linkage” group. (example: Red Hair + Freckles in Humans)

13. A linkage group is a group of genes that are located in the same physical area of a chromsome. This large region is called a locus. A linkage map shows the relative distance along the chromosome where genes are located.

14. You won’t need to know how to solve mapping questions. Be able to -Define Linkage Be able to discuss the importance of recombination frequencies to the localization of genes on chromosomes. Identify why linked genes do not follow the law of independent assortment

15. Polyploidy Euploidy Aneuploidy Polyploidy & Plants

16. Definition: When chromosomes inappropriately segregate Can Occur in: Meiosis I: both homologs go to one cell. Meiosis II: both sister chromatids go to one cell. Results in monosomy and trisomy Example: Down’s Syndrome

17. Nondisjunction can also happen in sex chromosomes Turner Syndrome (XO) Klinefelter Syndrome (XXY) Supermales (XYY) Superfemales (‘metafemale’) (XXX)

18. Deletions (cri-du-chat: loss of chromosome 5’s end) Inversions Duplications (Fragile X Syndrome, pg 208) Translocations (CML  chromosome 22  9)