1. Sophie THOMAS, PhD Hôpital Necker - Enfants Malades Institut Imagine - INSERM UMR 1163 Identification d’un nouveau gène de ciliopathies, KIAA0586, dont les mutations sont responsables d’un spectre phénotypique sévère de type Hydrolethalus et côtes courtes-polydactylie

2. Chevauchement phénotypique des ciliopathies viables et létales Jeune Asphyxiating Thoracic Dysplasia (JATD) Short rib-polydactyly Syndromes (SRP) Meckel syndrome (MKS) liver kidney Hydrolethalus syndrome (HLS) Joubert syndrome (JS) Acrocallosal syndrome (ACLS) Lethal Viable Severity

3. Exencephaly I:1 I:2 II:1II:2II:3II:4 Family 1 P d.1 Polydactyly Famille consanguine libanaise avec syndrome Hydrolethalus Alby et al. AJHG 2015 Filtering the variants dbSNP, 1kG, ExaC Exonic and splice With consequence 6263 1875 1120 31 Homozygous 1 Total variants GAPDH Exon 2 containing KIAA0586 transcripts Fetus II:3 Control RNA from cerebral tissue NGS: ciliome (S. Saunier) Mutation stop homozygote dans le gène KIAA0586

4. KIAA0586 : orthologue humain de Talpid3 NGS ciblé sur cas de SRP (V. Cormier-Daire and C. Huber) Ede et al. 1964 Davey et al. 2014

5. Family 2 II:1II:2II:3 29 gw d. 60’ Family 4 II:1II:2II:3II:5II:4 I:1 I:2 d.126 gw II:1II:2 I:1I:2 <10 gw d.13 mo Family 3 I:1 I:2 II:2 A-8 A-9 A-10 A-13 A-12 A-14 A-15 A-16 II:5 A-11 II:2 A-7 A-2 A-3 A-1 A-4 A-5 A-6 KIAA0586 c.1815G>A, p.(=); Homozygote ; exon 14 Identification d’un variant synonyme de KIAA0586 dans 3 familles SRP Alby et al. AJHG 2015 Exon 13 Exon 14 Exon 15 * CTACCAACAGAGAGATGTCAGAGA Exon 13Exon 14 Exon 13 Exon 15 Control cDNA F2-II:2 cDNA ACTB F2-II:2 F2-II:3 Control CTACCAACAGAGGATGAACTGTCAAG 1644 aa 606 aa

6. Family 2 II:1II:2II:3 29 gw d. 60’ Family 4 II:1II:2II:3II:5II:4 I:1 I:2 d.126 gw II:1II:2 I:1I:2 <10 gw d.13 mo Family 3 I:1 I:2 KIAA0586 c.1815G>A, p.(=); Homozygote ; exon 14 Identification d’un variant synonyme de KIAA0586 dans 3 familles SRP Alby et al. AJHG 2015 Exon 13 Exon 14 Exon 15 * CTACCAACAGAGAGATGTCAGAGA Exon 13Exon 14 Exon 13 Exon 15 Control cDNA F2-II:2 cDNA ACTB F2-II:2 F2-II:3 Control CTACCAACAGAGGATGAACTGTCAAG 1644 aa 606 aa

7. Hedgehog pathway induction Control II:2 Control II:2 GLI1 PTCH1 GLI3-FL GLI3-R Control 1Control 2 II:2 ATCB 160KDa 110KDa 80KDa 40KDa Les mutations de KIAA0586 sont associées à un défaut de ciliogenèse et de signalisation SHH Alby et al. AJHG 2015 Adapted from Kobayashi et al. 2014 SAPs DAPs Satellites

8. Conclusions  KIAA0586 : Novel ciliopathy gene  Lethal ciliopathies: from Hydrolethalus to SRP phenotypes  Viable ciliopathies : Joubert syndrome w/wo JATD Louise A Stephen, et al. eLife 2015;10 TALPID3 controls centrosome and cell polarity and the human ortholog KIAA0586 is mutated in Joubert syndrome (JBTS23) Ruxandra Bachmann-Gagescu, et al. Human Mutations 2015, Vol 36, No.9, 831-835 Functional genome-wide siRNA screen identifies KIAA0586 as mutated in Joubert syndrome Susanne Roosing et al. eLife 2015; 4

9. Conclusions  KIAA0586 mutations cause ciliogenesis defects leading to abnormal SHH signaling  KIAA0586 : Novel ciliopathy gene  Lethal ciliopathies: from Hydrolethalus to SRP phenotypes  Viable ciliopathies : Joubert syndrome w/wo JATD

10. Conclusions  KIAA0586 mutations cause ciliogenesis defects leading to abnormal SHH signaling  KIAA0586 mutations cause abnormal satellites removal required for ciliogenesis Adapted from Kobayashi et al. 2014 SAPs DAPs Satellites  KIAA0586 : Novel ciliopathy gene  Lethal ciliopathies: From Hydrolethalus to SRP phenotypes  Viable ciliopathies : Joubert syndrome w/wo JATD

11. Bettina Bessières Nicole Laurent Ferechté Razavi INSERM UMR1163 Caroline Alby Kevin Piquand Céline Huber Nadia El Khartoufi Amale Ichkou Michel Vekemans Arnold Munnich Stanislas Lyonnet Sophie Saunier Valérie Cormier-Daire Tania Attié-Bitach Cell Imaging & Genomics & Bioinformatics Meriem Garfa Traouré Christine Bole-Feysot Patrick Nistchke Société Française de Fœtopathologie

13. Ruxandra Bachmann-Gagescu, et al.

14. Chevauchement phénotypique des ciliopathies viables et létales Jeune Asphyxiating Thoracic Dysplasia (JATD) Short rib-polydactyly Syndromes (SRP) Meckel syndrome (MKS) liver kidney Hydrolethalus syndrome (HLS) Joubert syndrome (JS) Acrocallosal syndrome (ACLS) Lethal Viable Severity

15. Functional genome-wide siRNA screen identifies KIAA0586 as mutated in Joubert syndrome Susanne Roosing et al. eLife 2015; 4

16. ciliopathies Animal models Ciliary candidates Customized “ciliome” capture library Ciliary function/structure (From genomic & proteomic comparative studies) 1644 candidat genes Ciliary protein interactants

17. Hedgehog pathway induction Control II:2 Control II:2 GLI1 PTCH1 GLI3-FL GLI3-R Control 1Control 2 II:2 ATCB 160KDa 110KDa 80KDa 40KDa Les mutations de KIAA0586 sont associées à un défaut de ciliogenèse et de signalisation SHH Alby et al. AJHG 2015 SAPs DAPs Adapted from Kobayashi et al. 2014

18. Hedgehog pathway induction Control II:2 Control II:2 GLI1 PTCH1 GLI3-FL GLI3-R Control 1Control 2 II:2 ATCB 160KDa 110KDa 80KDa 40KDa Les mutations de KIAA0586 sont associées à un défaut de ciliogenèse et de signalisation SHH Alby et al. AJHG 2015 Adapted from Kobayashi et al. 2014 Satellites SAPs DAPs Adapted from Kobayashi et al. 2014