1. DNA 101, Sequencing

2. Double Helix Structure of DNA

3. DNA - (it is the genetic code that contains all the information needed to build and maintain an organism)

4. Each Base is Called a Nucleotide

6. DNA (Deoxyribonucleic acid) is a chemical structure that forms chromosomes

7. Human cells contain 23 pairs of chromosomes for a total of 46. There are 22 pairs of autosomes and one pair of sex chromosomes

8. Human Eggs from the Mother contain an X Sex Chromosome Human Sperm from the Father contain an X or Y Sex Chromosome

9. Females = XX Males = XY

10. The human genome is composed of 46 chromosomes, with a total of 3 billion base pairs

13. One of these DNA Samples was found at a crime scene and the others are from suspects.

14. DNA Codon Worksheet LettersSequence BeginningBB F I R S T N A M E BreakBB Middle Initial BaseColorNucleotides AAdenine TThymine CCytosine GGuanine

15. AAlanineGCT NAsparagineGAC BGCA OGAT CCysteineTGC PProlineCCC DAspartic acidGAT QGlutamineGAG EGlutamic acidGAG RArginineCGT FPhenylalanineTTT SSerineTCA GGlycineGGG TThreonineACT HHistidineCAT UACG IIsoleucineATA VValineGTC JATC WTryptophanTGG KLysineAAG XGTA LLeucineCTC YTyrosineTAC MMethionineATG Z TAT

16. A mutation is a permanent change in the nucleotide sequence of a gene or another part of the DNA Mighty Mutations

17. Base Name CODONS SICENCE AGCTGCATAGAAAACTGCGAA Previous Codons AGCTGCATAGAAAACTGCGAA No Mutations in the sequence of the codons

18. Mighty Mutations Base Name CODONS SIRENCE AGCCGCATAGAAAACTGCGAA Previous Codons AGCTGCATAGAAAACTGCGAA Missense Mutations The missense mutation changes one nucleotide in a codon, which can result in a completely different amino acid being added to the protein. Missense is a type of point mutation.

19. Missense Mutations Sickle blood cells among healthy human red blood cells. Sickle cell anemia is an inherited blood disease. The hemoglobin in normal red blood cells carries oxygen from the lungs to organs and tissues and brings back carbon dioxide to the lungs. In sickle cell blood hemoglobin is defective. After carrying oxygen to organs and tissues it may cluster together and form rod like structures causing the red blood cell to become stiff and to form the sickle shape. Sickle cells become stuck in capillaries, depriving the body of oxygen and causing inflammation. Sickle cell anemia sufferers have shortened life spans. However, in areas of the world where malaria is a problem, the survival rate of sickle cell carriers is actually increased, due to anemia related immunity to malaria.

20. Mighty Mutations Base Name CODONS SICSTOP AGCTGCATATAA Previous Codons AGCTGCATAGAAAACTGCGAA Nonsense Mutations The nonsense mutation changes the codon sequence for one amino to a STOP codon (TAA, TGA, TAG) that stops the cell from adding more amino acids to the protein. This point mutation shortens the protein.

21. Nonsense Mutations This x-ray of a hand of a patient with thalassemia shows demineralization (light patches). Thalassemia is an inherited autosomal recessive blood disease. In thalassemia, the genetic defect results in reduced rate of synthesis of one of the globin chains that make up hemoglobin. Reduced synthesis of one of the globin chains can cause the formation of abnormal hemoglobin molecules, thus causing anemia, the characteristic presenting symptom of the thalassemias.

22. Mighty Mutations Base Name CODONS SICENCE AGTTGCATAGAAAACTGCGAA Previous Codons AGCTGCATAGAAAACTGCGAA Silent Mutations Did you notice that the A was replaced with C in the DNA sequence? This silent mutation changes the codon sequence for one amino to another codon of the same amino acid. Even a slight change in the DNA sequence, sometimes does not change how the protein turns out- that's why it's called a silent mutation.

23. Silent mutations are DNA mutations that do not result in a change to the amino acid sequence of a protein. They may occur in a non-coding region, or they may occur in a manner that does not alter the final amino acid sequence. The phrase silent mutation is often used interchangeably with the phrase synonymous mutation because it does not result in a change of sequence. Because silent mutations do not alter protein function they are often treated as though they are evolutionarily neutral. However, many organisms are known to exhibit codon usage biases, suggesting that there is selection for the use of particular codons due to translational stability. Silent mutations may also affect splicing, or transcriptional control. Silent Mutations

24. In molecular cloning experiments, it can be useful to introduce silent mutations into a gene of interest in order to create or remove recognition sites for restriction enzymes. An online tool that can analyze a sequence of interest for possible mutations to create restriction sites is given in the External Links section. Recent results suggest that silent mutations can have an effect on subsequent protein structure and activity. Silent Mutations

25. Mighty Mutations Base Name CODONS SKAUB AGCGCATAGAAAACTGCGAA Previous Codons AGCTGCATAGAAAACTGCGAA Deletion Mutations Did you notice that one of the nucleotides is missing? The deletion mutation removes a portion of the DNA sequence. Since the DNA code is read by grouping three nucleotides, the deletion mutation changes how the rest of the code will be read by changing the total number of nucleotides.

26. Deletion Mutations The most common deletion mutation is cystic fibrosis. This is the deletion of a codon in a gene, which causes the protein the gene makes to lose an amino acid. Cystic fibrosis (also known as CF) is a genetic disorder known to be an inherited disease of the secretory glands, including the glands that make mucus and sweat. Although technically a rare disease, cystic fibrosis is ranked as one of the most widespread life-shortening genetic diseases.

27. Mighty Mutations Base Name CODONS SKCDL AGCTGCGATAGAAAACTGCGA Previous Codons AGCTGCATAGAAAACTGCGAA Insertion Mutations Did you notice that one of the nucleotides was added? The insertion mutation adds a nucleotide to the DNA sequence. Since the DNA code is read by grouping three nucleotides, the insertion mutation changes how the rest of the code will be read by changing the total number of nucleotides. RR A

28. Insertion Mutations Huntington's disease is a neurodegenerative condition. It is caused by the repeated insertion of nucleotides in the Huntington gene. The disease destroys cells in the basal ganglia, the part of the brain that controls movement, emotion, and cognitive ability. HD is caused by a mutation in a gene on chromosome 4. The job of its protein product, huntingtin, is to direct the delivery of important molecules to the outside of the cell. Normally, the coding region of this gene contains the DNA sequence “CAG” repeated again and again. The number of times this triplet is repeated varies from person to person, ranging from 10 to 26 times. People with HD have an abnormally high number of these CAG triplets, approximately 40 or more.

29. DNA 101, Sequencing