1. National Postdoc Appreciation Week
Hands-on CRISPR/Cas9 Design Workshop Exploring CRISPR/Cas9 Systems with the Biomedical Research Core Facilities
Thomas Saunders, Ph.D.
National Postdoc Appreciation Week
September 19, 2014

2. Genome Editing: Wild Type Cas9
Ran et al Nat Protoc. 8:2281

3. Genome Editing: Cas9 Nickase
Ran et al Nat Protoc. 8:2281

4. Workshop Goals Install Lasergene Software Find Mouse Gene Names
Find Genomic Sequence
Submit Genomic Sequence for sgRNA
Select sgRNA for knockouts/knockins
Cas9 Cloning Strategy in
pX330/pX458/pX459/pX460 plasmids
Order Oligos for Cas9 Plasmids

5. Download DNAStar Software
Or use Search Term
“MSIS Medical School Applications”
click on "login" kerberos password
click on "Medical School Software”
scroll down to "Lasergene” & install

10. A Famous Gene: P53

11. Find Genomic Sequence

12. Find Genomic Sequence

13. Find Gene Name

14. Find Gene Name

15. Find Genomic Sequence

19. Select All Text & Copy

20. Use Paste Special to Paste Text

21. Save File as .txt

22. Save File as .txt

23. Open Trp53 mus.txt in SeqBuilder

24. Save as Trp53 mus.sbd File

25. Identify Critical Exon for Knockout

26. Identify Critical Exon for Knockout

27. Identify Critical Exon for Knockout

28. Identify Critical Exon for Knockout

29. Find Critical Exon Sequence

30. Paste Sequence into Online CRISPR Tool

31. Paste Sequence into Online CRISPR Tool

32. Paste Sequence into Online CRISPR Tool

33. Paste Sequence into Online CRISPR Tool

34. Online CRISPR Tool Exon 2 (83 bp)

35. Exon 2 Results (83 bp) 2

36. Exon 2 Results (83 bp)

37. Online CRISPR Tool Exon 4 (261 bp)

38. Exon 4 Results (261 bp)

39. Exon 4 Results (261 bp)

40. Exon 4 Potential Off Target Hits

41. Exon 4 sgRNA Target
5’ AGTGAAGCCCTCCGAGTGTC AGG 3’
PAM

42. Ran, et al Nat Protoc. 8:

43. pX330 Plasmid Addgene.org Plasmid 42230 pX460 Plasmid
Cas9 Nickase
Ran, et al Nat Protoc. 8:

44. pX459 (GFP) Addgene.org Plasmid 48138 pX458 (puro)
Ran, et al Nat Protoc. 8:

45. pX330 Plasmid Addgene.org Plasmid 42230
Ran, et al Nat Protoc. 8:

46. Ran, et al Nat Protoc. 8:

47. Exon 4 sgRNA Target Oligos to Synthesize 5’ AGTGAAGCCCTCCGAGTGTC 3’
3’ TCACTTCGGGAGGCTCACAG 5’
Oligos to Synthesize
5’ CACCGAGTGAAGCCCTCCGAGTGTC
3’ CTCACTTCGGGAGGCTCACAGCAAA

48. Clone into pX330 See Ran, et al. 2013. Nat Protoc
Clone into pX330 See Ran, et al Nat Protoc. 8: for experimental methods
Anneal Oligos
Ligate into pX330 plasmid digested with Bbs I
Transform bacteria
Analyze colonies for correct sequence insertion
Test Plasmid for activity in vitro or in vivo

49. Mutation Screening by Analysis of PCR Fragments

50. Cas9 Targeting in ES Cells

51. Mutation in Cultured Mouse Eggs
ACCACTCCCTATCTTTCTTCTCCCTCCCTGCAGGTATGAATGCTGCCGTCA
DNA Example Chromatogram Reveals Mutation:
Superimposed Mutant and Wild Type “Peaks-on-Peaks” Sequences.

52. Mutant Mouse Pups
Cel I

53. Mutation in Mouse Founder
ACCACTCCCTATCTTTCTTCTCCCTCCCTGCAGGTATG----CTGCCGTCA
ACCACTCCCTATCTTTCTTCTCCCTCCCTGCAGGTATGCTGCCGTCAGGGC
Mutant Mouse Sequence – Out of Frame mRNA

54. Transgenic Core Expertise
As new investments are made into the cores, our main goal is just to make sure that the main BRCF audience – U-M faculty, staff, Pis, post-docs, grad students and researchers know about all of the resources and expertise the BRCF have to offer.