1. Gregor Mendel discovered basic laws of heredity using pea plants

2. Francis Crick & James Watson developed the first model of DNA Watson & Crick concluded that all living cells contain DNA

3. Cells contain the nucleus The nucleus is the “brains” of the cell Chromosomes are found inside the nucleus Chromosomes contain genes Genes are made up of DNA

4. Each trait is controlled by two (2) genes One of the two genes comes your mother & one from your father Genes are carried in the sex cells Eggs are the female sex cell and sperm the male

5. Sex cells are created through a process called meiosis in which DNA is copied Sex cells have 1/2 the number of chromosomes Random errors can occur while copying; this is called a mutation

6. DNA replication – Mitosis & Meiosis

7. Discovering the structure of DNA DNA = Deoxyribose nucleic acid Present in all living cells Contains all the information Nucleotides: a subunit that consists of: a sugar (deoxyribose) a phosphate and one nitrogen base – 4 different bases Adenine (A) and Thymine (T) Guanine (G) and Cytosine (C)

8. DNA Base Pairs Made up of nitrogen bases, sugar and phosphates DNA is made up of repeating units of Bases Bases always pair up; these are called base pairs Adenine always pairs with thymine Guanine always pairs with cytosine Base pairs code for proteins and proteins code for your genes There are about 3 billion base pairs that make up the human genome (all 23 chromosomes or all 35,000 genes) Note: if typed, 3 billion base pairs would take up 200 telephone books!

9. DNA – What does my code look like? Computer Code: 100101001110100011001010011100101111001010010010010 01011100101000101010010010100101010010010100101001 010100101001010010101010101001010100101010111111100 DNA Code: ATTCGGGGCCTTAAGACATTAATTTCCCAAG AAGAGATAAACTAGAGAGACCCTTTAAAACA CACAGAGATAGACAGAAAAACAATAGACAGA TACAGATAGACATAAAAAATTTTTTGGGAAA …millions and millions of bases…

10. Practice DNA Base Pairs

11. DNA replication – helix unzips

13. DNA replication – two strands are separated

14. DNA replication – each side is now a template

15. DNA replication – two identical strands of DNA Original DNA strands

16. DNA replication Newly assembled DNA strands

17. DNA replication Semi-conservative replication

18. Click on the link below to try to transcribe and translate the genes http://www.nobelprize.org/educational/medicine/ dna_double_helix/dnahelix.html http://learn.genetics.utah.edu/content/molecules /transcribe/ Design your DNA model for tomorrow’s lab using licorice, toothpicks and gummy bears/colored marshmallows.