Presentation is loading. Please wait.

Presentation is loading. Please wait.

Gregor Mendel discovered basic laws of heredity using pea plants.

Similar presentations


Presentation on theme: "Gregor Mendel discovered basic laws of heredity using pea plants."— Presentation transcript:

1 Gregor Mendel discovered basic laws of heredity using pea plants

2 Francis Crick & James Watson developed the first model of DNA Watson & Crick concluded that all living cells contain DNA

3 Cells contain the nucleus The nucleus is the “brains” of the cell Chromosomes are found inside the nucleus Chromosomes contain genes Genes are made up of DNA

4 Each trait is controlled by two (2) genes One of the two genes comes your mother & one from your father Genes are carried in the sex cells Eggs are the female sex cell and sperm the male

5 Sex cells are created through a process called meiosis in which DNA is copied Sex cells have 1/2 the number of chromosomes Random errors can occur while copying; this is called a mutation

6 DNA replication – Mitosis & Meiosis

7 Discovering the structure of DNA DNA = Deoxyribose nucleic acid Present in all living cells Contains all the information Nucleotides: a subunit that consists of: a sugar (deoxyribose) a phosphate and one nitrogen base – 4 different bases Adenine (A) and Thymine (T) Guanine (G) and Cytosine (C)

8 DNA Base Pairs Made up of nitrogen bases, sugar and phosphates DNA is made up of repeating units of Bases Bases always pair up; these are called base pairs Adenine always pairs with thymine Guanine always pairs with cytosine Base pairs code for proteins and proteins code for your genes There are about 3 billion base pairs that make up the human genome (all 23 chromosomes or all 35,000 genes) Note: if typed, 3 billion base pairs would take up 200 telephone books!

9 DNA – What does my code look like? Computer Code: 100101001110100011001010011100101111001010010010010 01011100101000101010010010100101010010010100101001 010100101001010010101010101001010100101010111111100 DNA Code: ATTCGGGGCCTTAAGACATTAATTTCCCAAG AAGAGATAAACTAGAGAGACCCTTTAAAACA CACAGAGATAGACAGAAAAACAATAGACAGA TACAGATAGACATAAAAAATTTTTTGGGAAA …millions and millions of bases…

10 Practice DNA Base Pairs

11 DNA replication – helix unzips

12

13 DNA replication – two strands are separated

14 DNA replication – each side is now a template

15 DNA replication – two identical strands of DNA Original DNA strands

16 DNA replication Newly assembled DNA strands

17 DNA replication Semi-conservative replication

18 Click on the link below to try to transcribe and translate the genes http://www.nobelprize.org/educational/medicine/ dna_double_helix/dnahelix.html http://learn.genetics.utah.edu/content/molecules /transcribe/ Design your DNA model for tomorrow’s lab using licorice, toothpicks and gummy bears/colored marshmallows.


Download ppt "Gregor Mendel discovered basic laws of heredity using pea plants."

Similar presentations


Ads by Google