1. What should a bioinformatician know about DNA sequencing, and why?

2. Update this table: remove SOLiD, add Life Technologies Ion Proton (PGM), Illumina MiSeq Update all with latest info on read length

3. What are the error types and rates of the different platforms?

4. Quality scores Phred www.phrap.com/phred/www.phrap.com/phred/ Q = -10 log 10 (e) Quality scoreProb wrong base callAccuracy of base call 101/1090% 201/10099% 301/100099.9% 401/10,00099.99% 501/100,00099.999%

5. Wikipedia.org

6. FASTQ format 4 lines, sequence + quality scores @SEQ_ID (+optional description) GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + optional repeat of line 1, often left as just the + character to save space !''*((((***+))%%++)(%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 But beware! At least 3 different FASTQ file standards, indistinguishable in format, but incompatible with each other Wikipedia.org

7. FASTQ variants NameASCII range, offsetQ score typeQ score range Sanger standard; fastq-sanger 33-126, 33PHRED0 to 93 (raw 0-40) Solexa/Illumina <1.3 fastq-solexa 59-126, 64Solexa-5 to 62 (raw -5-40) Illumina 1.3+ fastq-illumina 64-126, 64PHRED0 to 62 (raw 0-40) Illumina 1.5+64-126, 64PHRED3 to 62 (raw 3-40) Illumina 1.8+33-126, 33PHRED0 to 93 (raw 0-41)

8. What use is the quality score?

9. What factors should be considered in the choice of a DNA sequencing platform?