2. Polymers DNA Structure and Function

3. History of DNA  Scientists were aware that DNA had a sugar phosphate background and had bases A, T, G and C but were not sure about the actual shape of DNA.  Wilkins and Franklin used X-ray crystallography to create images of DNA’s structure.  Watson discovered that the base pairs A to T were exactly as long as G to C. Causing each rung to be of equal length

4. Founders  Now that they had the shape – helical or twisted ladder – and the base pairing rule, they could share with the scientific community the shape of DNA. NOBEL PRIZE awarded to Watson and Crick shared with Wilkins and Franklin for discovering the shape of DNA.

5. Nucleic acids  DNA – Deoxyribonucleic Acid – a simple polymer  the “molecule of heredity.” DNA Animation http://www.youtube.com/w atch?v=l- hrLs03KjY&feature=r elated http://www.youtube.com/w atch?v=l- hrLs03KjY&feature=r elated

6. Job of DNA  Stores information on how to make proteins; the building–blocks of living organisms Hydrogen Bonds phosphate Sugar SHAPE – Double helix

7. What is a Monomer  the simple building blocks used to hook together to build long, complex polymers ex. Keratin (protein in hair), Nylon, plastics,…

8. What is a Nucleotide?  Sugar  Phosphates  Bases N N O O H CH 3 CH 2 CC O C C OH O P O O A Nucleotide What are the components found in nucleotides? The monomers that builds up the DNA polymers

9. SugarPhosphate C 6 H 12 O 6 Found on DNA HOCH 2 OH CC O C C H HOCH 2 OH CC O C C H DNA is found in the Nucleus Ribose Deoxyribose Sides of the ladder Backbone of DNA

10. Types of Bases GuanineThymineCytosine H N N NH 2 N N N N OH HO H N N OH N N H2NH2N N N O O H CH 3 H N N NH 2 HO Adenine Uracil – only in RNA

11. Purines and Pyrimidines Purines- double ringed Pyrimidines – single ringed

12. Which Bases Pair Together A = T C = G Why do they pair together? Hydrogen bonds A = T has two bonds G = C has three bonds

13. Anti-parallel-What does it mean?

14. What are Genes? Long stretches of DNA that are “recipes” for how to build a specific protein.  For example: the gene for Kertain is a stretch of DNA with instructions for building a Keratin molecule

15. Summary Flow Chart

16. How are genes, proteins, traits, DNA and chromosomes related?  traits are the result of proteins  Proteins are determined by a stretch of DNA called a gene.  Genes are stretches of DNA on a chromosome.  DNA codes for the proteins that make up traits

17. What could happen if genes had the wrong sequence of nucleotides?  Incorrect proteins could be made. This could lead to disease, spontaneous abortion, cancer or death. Called a Mutation

18.  When does DNA remake itself?  Interphase  3 parts to Interphase  G1 – cell carries out normal functions  S – DNA is copied  G2 – Cell carries out normal functions Mitosis G1 S G2 Cell Cycle DNA Synthesis

19.  What must be present for DNA to remake itself?  Original  Ink and paper  Photocopier Original DNA Nucleotide DNA Polymerase

20.  Original Strand The original strand is used as a template Example:

21.  A nucleotide is the sugar, phosphate and base.  Where do the “free” nucleotides come from?  From the food that we eat  Adenine, Thymine, Cytosine, Guanine

22.  What is an enzyme?  An enzyme is a protein  “Cellular Machine” that can build up or tear apart molecules.

23. DNA replication wrap up http://www.youtube.com/watch?v=hfZ8o9D1tus a.Template (original) Strand – original strand used to tell what nucleotide to add b. Newly Synthesized (copy) Strand – just being built, a copy of the original strand

24.  What happens during DNA replication? a. - DNA unzips  Helicase unwinds DNA double helix; breaks hydrogen bonds

25. b. - DNA polymerase attaches to DNA

26. c. DNA polymerase copies DNA Free nucleotides find their compliments on each side of the DNA strand Free nucleotides find their compliments on each side of the DNA strand

27. 12 New bases keep attaching until two identical molecules of DNA are created. This is called semi- conservative replication. THE RESULT: 2 new DNA molecules, each is ½ old strand, ½ new strand Mitosis then follows where each cell gets copy

28. A – T T – A G – C A – T C - G AT TA GC AT CG A – T – G – A – C – A T G A C T A C T G - T - A - C - T - G DNA unzips Hydrogen bonds broken DNA is copied Free nucleotides attached

29. A – T T – A G – C A – T C - G ATTAGCATCGATTAGCATCG A – T – G – A – C – ATGACATGAC TACTGTACTG - T - A - C - T - G Template Strand Old DNA strand

30. A – T T – A G – C A – T C - G ATTAGCATCGATTAGCATCG A – T – G – A – C – ATGACATGAC TACTGTACTG - T - A - C - T - G Copy Strands New DNA Strand

32.  Reads in an anti- parallel direction when bringing in free nucleotides EX:

33.  http://www.dnalc.org/view/15509-DNA- replication-animation-3D-animation-with- basic-narration.html http://www.dnalc.org/view/15509-DNA- replication-animation-3D-animation-with- basic-narration.html http://www.dnalc.org/view/15509-DNA- replication-animation-3D-animation-with- basic-narration.htmlVideo http://www.youtube.com/watch?v=zdDkiRw 1PdU&feature=related http://www.youtube.com/watch?v=zdDkiRw 1PdU&feature=related Song: http://www.youtube.com/watch?v=dIZpb9 3NYlw&feature=related http://www.youtube.com/watch?v=dIZpb9 3NYlw&feature=related http://www.youtube.com/watch?v=dIZpb9 3NYlw&feature=related

34. http://www.contexo.info/DNA_Basics/DNA%20Replication.htm http://www.teachersdomain.org/sci/life/gen/mechdna/index.html ANIMATIONS

35. Proteins  Subunits of life Monomers – Amino Acids Polymers – many A.A. joined together to form a polypeptide chain

36. To Recognize  Amino group NH 2 or NH (circle in green)  Carboxyl COOH or CO (circle in red) These are the “side chains” or R groups – makes each amino acid different from one another

37. Proteins – long chain of amino acids bonded together  Peptide bond (Circle in figure below) Amino Acid Peptide Bond

38. Organisms build proteins from 20 amino acids  Flip and look at the page with our 20 amino acids.  Don’t need to memorize these, but notice……ALL have an NH 2 and a COOH group.

39. Why are protein important?  Enzymes – speed up biological reactions  Antibodies – immune system  Channels – allow ions through cell membrane by creating channels

40. Types of Proteins Enzymatic (speed up/control chemical reactions)  Catalase – located in plants, animals and aerobic bacteria to break down hydrogen peroxide (otherwise harmful, toxic) into water and oxygen H 2 O 2  H 2 O + O 2 H 2 O 2 poison builds up as we digest food In the liver H 2 O 2 is changed to water and oxygen by Catalase

41.  Rhodopsin – a protein in the membrane in the photoreceptor cell in the retina in the eye. This part changes shape when light hits it and leads to a nerve impulse to being transmitted to the brain

42.  Structural (our building blocks) actin and myosin work together to help the muscle cells relax and contract

43.  Oxygen Carriers – Hemoglobin is two proteins (alpha and beta) are in red blood cells that “stick together” They carry oxygen

44.  Hormones (send signals) – Insulin- binds and changes shape of receptor to form a tunnel to allow entry of molecules such as glucose into the cells.

45. Now that you understand:  What determines the role or function of a protein? Shape  What determines the shape of a protein? Function