Presentation is loading. Please wait.

Presentation is loading. Please wait.

Neuroendocrine Tumour Biobank Dr Chrissie Thirlwell Cancer Research UK Clinician Scientist Senior Lecturer Medical Oncology Royal Free Hospital NET Unit.

Similar presentations


Presentation on theme: "Neuroendocrine Tumour Biobank Dr Chrissie Thirlwell Cancer Research UK Clinician Scientist Senior Lecturer Medical Oncology Royal Free Hospital NET Unit."— Presentation transcript:

1 Neuroendocrine Tumour Biobank Dr Chrissie Thirlwell Cancer Research UK Clinician Scientist Senior Lecturer Medical Oncology Royal Free Hospital NET Unit and UCL Cancer Institute Open Access Biobanks @ UCL 18 th April 2013 christina.thirlwell@ucl.ac.uk

2 European Centre of Excellence 2010 15 new cases/month >1500 cases under follow up NET Biobank Royal Free Academic NET Unit

3 RARE BUT high prevalence –0.5% malignancies 5/100 000 UK popn Sites –GI tract 62-67% –Lung 22-27% Survival –5yr OS 93% local disease, 74% regional, 19% metastatic disease –12-22% cases present with metastases Neuroendocrine Tumours

4 Yao, J. C. et al. J Clin Oncol; 26:3063-3072 2008 NET incidence rising

5 NET patient Hepatobiliary & GI surgery Radiology & Nuclear Medicine Oncology Pathology Gastroenterology Endocrinology Cardiology Genetics Dieticians Palliative care Specialist NET Nurses

6 Research Objectives Integrated genomic analysis of PNETs PNET DNA meth CNV Exome seq RNA exp cfDNA CTC

7 CGTTACGATGGACGGTATGCTCCGTAAG GENE OF INTEREST DNA SEQUENCE DNA METHYLATION RNA EXPRESSION COPY NUMBER ANALYSIS Integrated genomic PNET analysis

8 Why set up a NET biobank? Garbage in…… Diamonds in……

9 Governance Infrastructure Human Tissue Authority licence – prospective research tissue bank – framework and guidelines – allows satellite sites Research Ethics Committee approval R & D approval in each participating Trust

10 Management Infrastructure Policies and Procedures – Quality management system – Risk register – Disaster recovery plan – Incident log

11 Management Infrastructure Standard Operating Procedures – Collection – Storage – Processing – Equipment Robust tracking system Sample and data audits

12 What to collect?

13 Specialised samples Blood (circulating tumour cells, DNA, RNA, miRNA) Metastatic biopsies Cells from ascites/pleural effusions Carcinoid heart valves

14 Quality Assurance – FF tissue Sections are cut from frozen tissue and stained with haematoxylin and eosin Percentage tumour is assessed for each tumour block

15 Data entry and storage All samples are labelled with a 2D barcode label and scanned directly into the database to avoid transcription errors Each sample has an anonymised unique identifier Samples are then stored appropriately in the -80 o C freezer

16 NET Biobank Funding –Raymond and Beverly Sackler Foundation Prospectively consent and collect tissue / biological samples Robust infrastructure, HTA compliant

17 Benefits of banking within UCL/RFH Biobank Infrastructure Staff Resources Cheaper than going it alone Improves funding opportunities

18 NET BioBank Jan 2013 holdings Subjects218 Sampling events2678 Fresh tissue107 Serum1264 Plasma1280 Cell pellets99

19 Clinical Database Full time Clinical Data Manager Bespoke secure web accessed database –Interface with Cerner ~1000 patients entered Improve efficiency and quality of clinical audit and research

20 Key findings Integrated genomic analysis of PNETs PNET DNA meth CNV Exome seq RNA exp cfDNA CTC Novel DNAm biomarkers Wnt signalling DNAm enhancer regions Novel DNAm biomarkers Wnt signalling DNAm enhancer regions Reassignment of Ki-67 grading ARID1A mutation Supports DNAm findings

21 Summary =

22 Acknowledgements Royal Free NET Unit Tim Meyer Martyn Caplin Brian Davidson UCL Cancer Institute - Medical Genomics Stephan Beck Marianne Eymard Harpreet Dibra Laura Schulz Anna Karpathakis Serif Sasmaz Andy FeberUCL-RFH Biobank Lee Butcher Chris Bell UCL Genome Centre Kerra Pearce Mike Hubank Funding Cancer Research UK Raymond and Beverly Sackler Foundation Wellcome Trust / Academy of Medical Sciences contact: christina.thirlwell@ucl.ac.uk


Download ppt "Neuroendocrine Tumour Biobank Dr Chrissie Thirlwell Cancer Research UK Clinician Scientist Senior Lecturer Medical Oncology Royal Free Hospital NET Unit."

Similar presentations


Ads by Google