1. CAMPBELL BIOLOGY Reece Urry Cain Wasserman Minorsky Jackson © 2014 Pearson Education, Inc. TENTH EDITION CAMPBELL BIOLOGY Reece Urry Cain Wasserman Minorsky Jackson TENTH EDITION 20 DNA Tools and Biotechnology Lecture Presentation by Nicole Tunbridge and Kathleen Fitzpatrick

2. © 2014 Pearson Education, Inc. Figure 20.3 DNA (template strand) PrimerDeoxyribo- nucleotides Dideoxyribonucleotides (fluorescently tagged) DNA polymerase DNA (template strand) Labeled strands Direction of movement of strands Longest labeled strand Detector Laser Shortest labeled strand ShortestLongest Technique Results 5′5′ 5′5′ 5′5′ 5′5′ 5′5′ 3′3′ 3′3′ 3′3′ 3′3′ 3′3′ CTGACTTCGACAACTGACTTCGACAA CTGACTTCGACAACTGACTTCGACAA TGTTTGTT CTGTTCTGTT dATP GCTGTTGCTGTT CTGTTCTGTT CTGTTCTGTT CTGTTCTGTT CTGTTCTGTT CTGTTCTGTT GACTGAGACTGA AGCTGTTAGCTGTT ACTGAAGACTGAAG CTGAAGCTGAAG TGAAGTGAAG CTGTTCTGTT GAAGGAAG AAGAAG AGAG ddATP dCTP ddCTP dTTP ddTTP dGTP ddGTP PP P PP P G G Last nucleotide of longest labeled strand Last nucleotide of shortest labeled strand GACTGACT GAAGCGAAGC dd

3. © 2014 Pearson Education, Inc. Figure 20.4 Technique Genomic DNA is fragmented. Each fragment is isolated with a bead. Using PCR, 10 6 copies of each fragment are made, each attached to the bead by 5′ end. The bead is placed into a well with DNA polymerases and primers. A solution of each of the four nucleotides is added to all wells and then washed off. The entire process is then repeated. If a nucleotide is joined to a growing strand, PP i is released, causing a flash of light that is recorded. If a nucleotide is not complementary to the next template base, no PP i is released, and no flash of light is recorded. The process is repeated until every fragment has a complete complementary strand. The pattern of flashes reveals the sequence. Results 6 7 8 5 4 3 2 1 4-mer 3-mer 2-mer 1-mer A T G C Template strand of DNA Primer 3′3′ A 3′3′ 5′5′ 5′5′ T G C AT G CAT G CAT G C AT G C Template strand of DNA Primer DNA polymerase dATP dTTPdGTP dCTP PP i C C C C A A A A T T T G G G G C C C C A A A A T T T G G G G C C C C A A A A T T T G G G G C C C C A A A A T T T G G G G AA A A C

4. © 2014 Pearson Education, Inc. Figure 20.4a Technique Genomic DNA is fragmented. Each fragment is isolated with a bead. Using PCR, 10 6 copies of each fragment are made, each attached to the bead by 5′ end. The bead is placed into a well with DNA polymerases and primers. 4 Template strand of DNA Primer 3′3′ A 3′3′ 5′5′ 5′5′ T G C 3 2 1 5 A solution of each of the four nucleotides is added to all wells and then washed off. The entire process is then repeated.

5. © 2014 Pearson Education, Inc. Figure 20.4b 6 7 If a nucleotide is joined to a growing strand, PP i is released, causing a flash of light that is recorded. If a nucleotide is not complementary to the next template base, no PP i is released, and no flash of light is recorded. Template strand of DNA Primer DNA polymerase dATP dTTP PP i C C C C A A A A T T T G G G G Technique AT G CAT G C A C C C C A A A A T T T G G G G A

6. © 2014 Pearson Education, Inc. Figure 20.4c 8 Technique AT G C AT G C C C C C A A A A T T T G G G G C C C C A A A A T T T G G G G A A C dGTP dCTP PP i The process is repeated until every fragment has a complete complementary strand. The pattern of flashes reveals the sequence.

7. © 2014 Pearson Education, Inc. Figure 20.4d Results 4-mer 3-mer 2-mer 1-mer A T G C

8. © 2014 Pearson Education, Inc. Concept 20.3: Cloned organisms and stem cells are useful for basic research and other applications  Organismal cloning produces one or more organisms genetically identical to the “parent” that donated the single cell  A stem cell is a relatively unspecialized cell that can reproduce itself indefinitely, or under certain conditions can differentiate into one or more types of specialized cells

9. © 2014 Pearson Education, Inc. Cloning Plants: Single-Cell Cultures  In plants, cells can dedifferentiate and then give rise to all the specialized cell types of the organism  A totipotent cell, such as this, is one that can generate a complete new organism  Plant cloning is used extensively in agriculture

10. © 2014 Pearson Education, Inc. Figure 20.15 Cross section of carrot root Small fragments Fragments were cultured in nutrient medium; stirring caused single cells to shear off into the liquid. Single cells free in suspension began to divide. Embryonic plant developed from a cultured single cell. Plantlet was cultured on agar medium. Later it was planted in soil. Adult plant

11. © 2014 Pearson Education, Inc. Cloning Animals: Nuclear Transplantation  In nuclear transplantation, the nucleus of an unfertilized egg cell or zygote is replaced with the nucleus of a differentiated cell  Experiments with frog embryos have shown that a transplanted nucleus can often support normal development of the egg  However, the older the donor nucleus, the lower the percentage of normally developing tadpoles

12. © 2014 Pearson Education, Inc. Figure 20.16 Experiment Frog embryo UV Frog egg cellFrog tadpole Less differ- entiated cell Fully differ- entiated (intestinal) cell Donor nucleus trans- planted Enucleated egg cell Donor nucleus trans- planted Egg with donor nucleus activated to begin development Results Most develop into tadpoles. Most stop developing before tadpole stage.

13. © 2014 Pearson Education, Inc. Reproductive Cloning of Mammals  In 1997, Scottish researchers announced the birth of Dolly, a lamb cloned from an adult sheep by nuclear transplantation from a differentiated mammary cell  Dolly’s premature death in 2003, as well as her arthritis, led to speculation that her cells were not as healthy as those of a normal sheep, possibly reflecting incomplete reprogramming of the original transplanted nucleus

14. © 2014 Pearson Education, Inc. Figure 20.17 Technique 1 2 3 4 5 6 Mammary cell donor Results Egg cell donor Egg cell from ovary Cultured mammary cells Nucleus removed Cells fused Nucleus from mammary cell Grown in culture Early embryo Implanted in uterus of a third sheep Surrogate mother Embryonic development Lamb (“Dolly”) genetically identical to mammary cell donor

15. © 2014 Pearson Education, Inc.  Since 1997, cloning has been demonstrated in many mammals, including mice, cats, cows, horses, mules, pigs, and dogs  CC (for Carbon Copy) was the first cat cloned; however, CC differed somewhat from her female “parent”  Cloned animals do not always look or behave exactly the same

16. © 2014 Pearson Education, Inc. Figure 20.18

17. © 2014 Pearson Education, Inc. Faulty Gene Regulation in Cloned Animals  In most nuclear transplantation studies, only a small percentage of cloned embryos have developed normally to birth, and many cloned animals exhibit defects  Many epigenetic changes, such as acetylation of histones or methylation of DNA, must be reversed in the nucleus from a donor animal in order for genes to be expressed or repressed appropriately for early stages of development

18. © 2014 Pearson Education, Inc. Stem Cells of Animals  Stem cells are relatively unspecialized cells that can both reproduce indefinitely and, under certain conditions, differentiate into one or more specialized cell types

19. © 2014 Pearson Education, Inc. Figure 20.19 Stem cell Cell division Stem cell and Precursor cell Fat cellsor Bone cells or White blood cells

20. © 2014 Pearson Education, Inc. Embryonic and Adult Stem Cells  Many early embryos contain stem cells capable of giving rise to differentiated embryonic cells of any type  In culture, these embryonic stem cells reproduce indefinitely  Depending on culture conditions, they can be made to differentiate into a variety of specialized cells  Adult stem cells can generate multiple (but not all) cell types and are used in the body to replace nonreproducing cells as needed

21. © 2014 Pearson Education, Inc. Figure 20.20 Cells that can generate all embryonic cell types Cultured stem cells Cells that generate a limited number of cell types Different culture conditions Liver cellsNerve cells Blood cells Different types of differentiated cells Embryonic stem cells Adult stem cells

22. © 2014 Pearson Education, Inc.  Embryonic stem (ES) cells are pluripotent, capable of differentiating into many different cell types  The ultimate aim of research with stem cells is to supply cells for the repair of damaged or diseased organs  ES cells present ethical and political issues  Also, other complicating issues- what do you think they are?

23. © 2014 Pearson Education, Inc. Induced Pluripotent Stem (iPS) Cells  Researchers can treat differentiated cells, and reprogram them to act like ES cells  Researchers used retroviruses to induce extra copies of four stem cell master regulatory genes to produce induced pluripotent stem (iPS) cells  iPS cells can perform most of the functions of ES cells  iPS cells can be used as models for study of certain diseases and potentially as replacement cells for patients

24. © 2014 Pearson Education, Inc. Figure 20.21 Stem cellPrecursor cell Experiment Skin fibroblast cell Four “stem cell” master regulator genes were introduced, using the retroviral cloning vector. Induced pluripotent stem (iPS) cell Oct3/4 Sox2 c-Myc Klf4