1. How to Study DNA 1.Genetic material 2.Expression product

2. DNA as Genetic Material DNA encodes all the information in the cell The composition of the DNA is the same in all cells within an organism – –Variation among different cells is achieved by reading the DNA differently DNA contains four bases that encode all the information to make an organism’s life

3. DNA Meischer (1860’s) DNA slightly acidic and composed of large amounts of phosphorous and nitrogen DNA consists of four kinds of bases (A,C,G,T) joined to a sugar phosphate backbone Bases carry the genetic information while the phosphate backbone is structural Two complementary strands of bases (C- G) and (A-T)

4. DNA primary structure

5. DNA ( Deoxyribonucleic Acid) Deoxyribonucleotide Deoxy Ribo Nucleotide a Polymer of Deoxyribonucleotide Units

6. (dATP) Deoxyadenosine 5´-triphosphate DeoxyRibonucleotide DeoxyRibonucleoside Deoxyadenosine

7. O O=P-O O Phosphate Group N Nitrogenous base (A, G, C, or T) CH2 O C1C1 C4C4 C3C3 C2C2 5 Sugar (Deoxyribose) DeoxyRibonucleotide

8. 5-carbon sugar (Deoxy ribose) Nitrogenous base Phosphate group

9. Backbone Sugar Molecules Deoxyribose (DNA)Ribose (RNA) 1´ 2´ 3´ 4´ 5´ 1´ 2´ 3´ 4´ 5´ Ribose= Five Carbon Sugar Molecule Deoxy ribo nucleotide

10. NITROGEN BASES AdenineGuanine ThymineCytosine Two Purines Two Pyrimidines 9 9 1 1 It is composed of four different nitrogen bases

11. Nitrogenous Bases PURINES PURINES 1. Adenine (A) 2.Guanine (G) PYRIMIDINES PYRIMIDINES 3. Thymine (T) 4.Cytosine (C) T or C A or G

12. BASE-PAIRINGS Base # of Purines PyrimidinesPairs H-Bonds Adenine (A) Thymine (T)A = T 2 Guanine (G) Cytosine (C)C G 3 CG 3 H-bonds

13. BASE-PAIRINGS CG H-bonds T A

14. Base Pairing Occurs Through Hydrogen Bonds A-T G-C

15. Chargaff’s Rule Adenine must pair with Thymine Adenine must pair with Thymine Guanine must pair with Cytosine Guanine must pair with Cytosine Their amounts in a given DNA molecule will be about the same. Their amounts in a given DNA molecule will be about the same. G C TA

16. More of Chargaff’s Work In any sample of DNA the following is true: – –Amount of Cytosine = Amount of Guanine – –Amount of Thymine = Amount of Adenine

17. Polymerization of Nucleotides 5’ carbon 3’ carbon

18. Polynucleotides (Nucleic Acids) 5’ end 3’ end

19. The DNA Backbone is a Deoxyribose Polymer Deoxyribose sugars are linked by Phosphodiester Bonds 5´ 3´ 5´ 3´ 2´ 1´ 5´-p3´-OH 5´3´

20. 5´ 3´ 5´ 3´5´ 3´ 5´ 3´ 5´ 3´ 2´ 1´

21. 5´ 3´ 5´ 3´ 2´ 1´ Base 5´ 3´ 5´ 3´ 2´ 1´

22. 5´ 3´5´ 3´ T C T A G A

23. = GC AT

24. Double-stranded DNA Forms a Double Helix

25. DNA Double Helix Nitrogenous Base (A,T,G or C) “Rungs of ladder” “ Legs of ladder” Phosphate & Sugar Backbone

26. DNA Double Helix P P P O O O 1 2 3 4 5 5 3 3 5 P P P O O O 1 2 3 4 5 5 3 5 3 G C TA

27. RIBO NUCLEIC ACID A polymer composed of nucleotides that contain the sugar ribose and one of the four bases cytosine, adenine, guanine and uracile A polymer composed of nucleotides that contain the sugar ribose and one of the four bases cytosine, adenine, guanine and uracile Polynucleotide containing ribose sugar and uracile instead of thymine Polynucleotide containing ribose sugar and uracile instead of thymine Genetic material of some viruses Genetic material of some viruses Primary agent for transferring information from the genome to the protein synthetic machinery Primary agent for transferring information from the genome to the protein synthetic machinery

28. URACIL (U) base with a single-ring structure phosphate group sugar (ribose)

29. Types of RNA Three types of RNA: a)messenger RNA (mRNA) b)transfer RNA (tRNA) c)ribosome RNA (rRNA) Remember: Remember: All produced in the nucleus

30. A. Messenger RNA (mRNA) Carries the information for a specific protein. Carries the information for a specific protein. Made up of 500 to 1000 nucleotides long. Made up of 500 to 1000 nucleotides long. Made up of codons (sequence of three bases: AUG - methionine). Made up of codons (sequence of three bases: AUG - methionine). Each codon is specific for an amino acid. Each codon is specific for an amino acid.

31. Codon There are 20 different possible amino acids to make from different codons. 3 possible stop codon 1 start codon TAC on DNA AUG on RNA

32. Codon Chart Start Codon

33. Codon Chart

34. Messenger RNA (mRNA) Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1

35. B. Transfer RNA (tRNA) Made up of 75 to 80 nucleotides long. Picks up the appropriate amino acid floating in the cytoplasm (amino acid activating enzyme) Transports amino acids to the mRNA. Have anticodons that are complementary to mRNA codons. Recognizes the appropriate codons on the mRNA and bonds to them with H-bonds.

36. codon in mRNA anticodon amino acid OH amino acid attachment site anticodon tRNA molecules amino acid attachment site

37. The structure of transfer RNA (tRNA)

38. Transfer RNA (tRNA) amino acid attachment site UAC anticodon methionine amino acid

39. C. Ribosomal RNA (rRNA) Made up of rRNA is 100 to 3000 nucleotides long. Important structural component of a ribosome. Associates with proteins to form ribosomes.

40. Ribosomes Large and small subunits. Large and small subunits. Composed of rRNA (40%) and proteins (60%). Composed of rRNA (40%) and proteins (60%). Both units come together and help bind the mRNA and tRNA. Both units come together and help bind the mRNA and tRNA. Two sites for tRNA Two sites for tRNA a.P site (first and last tRNA will attach) b.A site

42. RibosomesOrigin Complete ribosome Ribosomal subunit rRNA components Proteins Cytosol (eukaryotic ribosome) 80 S 40 S 60 S 18 S 5 S 5 S 5.8 S 25 S C.30C.50 Chloroplasts (prokaryotic ribosome) 70 S 30 S 50 S 16 S 4.5 S 5 S 5 S 23 S C. 24 C. 35 Mitochondrion (prokaryotic ribosome) 78 S  30 S  50 S 18 S 5 S 5 S 26 S C. 33 C. 35

43. Ribosomes P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

44. Study of Genetic Material Number of chromosomesBanding Number of nucleotidesSequencing Structural genesCloning Non-structural genesMolecular marker

45. Central Dogma of Biology

46. DNA, RNA, and the Flow of Information Translation Transcription Replication

47. Central Dogma (Modifications) Transcription Translation DNA (1)Reverse transcription Replication RNA (2)Self Replication Protein (3)Self Replication (2)Ribozymes

48. DNA Replication 1.Origin of Replication 2.Strand Separation 3.Priming 4.Synthesis of new strand DNA

49. Origins of replication 1. 1.Replication Forks: Hundreds of Y-shaped regions of replicating DNA molecules where new strands are growing. ReplicationFork Parental DNA Molecule 3’ 5’ 3’ 5’ DNA Replication

50. Origins of replication 2.Replication Bubbles: Hundreds of replicating bubbles (eukaryotes). Bubbles DNA Replication

51. Strand Separation: Unwinding and separation of the parental double helix DNA 1. Helicase Enzyme which catalyze the breaking H-Bonds between 2 nitrogen bases from different strand. 2. Single-Strand Binding Proteins Proteins which attach and help keep the separated strands apart.

52. DNA Replication Strand Separation: 3.Topoisomerase enzyme which relieves stress on the DNA molecule by allowing free rotation around a single strand. Enzyme DNA Enzyme

53. DNA Replication Priming: The attachment of complementary primer on the single stranded DNA 1.RNA primers B Before new DNA strands can form, there must be small pre-existing primers (RNA) present to start the addition of new nucleotides (DNA Polymerase). 2.Primase E Enzyme that polymerizes (synthesizes) the RNA Primer

54. DNA Replication Synthesis of the new DNA Strands: The additional of nucleotide on RNA primer 1.DNA Polymerase with a RNA primer in place, DNA Polymerase (enzyme) catalyze the synthesis of a new DNA strand in the 5’ to 3’ direction. RNAPrimer DNA Polymerase Nucleotide 5’ 3’

55. DNA Replication Synthesis of the new DNA Strands 2.Leading Strand synthesized as a single polymer in the 5’ to 3’ direction. synthesized as a single polymer in the 5’ to 3’ direction. RNAPrimer DNA Polymerase Nucleotides 3’5’

56. DNA Replication Synthesis of the new DNA Strands 3.Lagging Strand It also synthesized in the 5’ to 3’ direction, but discontinuously against overall direction of replication. RNA Primer Leading Strand DNA Polymerase 5’5’ 5’ 3’ Lagging Strand 5’ 3’

57. DNA Replication Synthesis of the new DNA Strands 4.Okazaki Fragment series of short segments on the lagging strand. Lagging Strand RNA Primer DNA Polymerase 3’ 5’ Okazaki Fragment

58. DNA Replication Synthesis of the new DNA Strands 5.DNA ligase a linking enzyme that catalyzes the formation of a covalent bond from the 3’ to 5’ end of joining stands. Example: joining two Okazaki fragments together. Lagging Strand 2 Okazaki Fragment 2 DNA ligase Okazaki Fragment 1 5’ 3’

59. DNA Replication Synthesis of the new DNA Strands 6.Proofreading initial base-pairing errors are usually corrected by DNA polymerase.

60. DNA Replication Semiconservative Model Watson and Crick the two strands of the parental molecule separate, and each functions as a template for synthesis of a new complementary strand. Parental DNA DNA Template New DNA

61. DNA Repair Excision repair 1.Damaged segment is excised by a repair enzyme (there are over 50 repair enzymes). 2.DNA polymerase and DNA ligase replace and bond the new nucleotides together.

62. What is gene expression? The activation of a gene that results in a protein. The activation of a gene that results in a protein. Biological processes, such as transcription, and in case of proteins, also translation, that yield a gene product. A gene is expressed when its biological product is present and active. Gene expression is regulated at multiple levels.

63. Expression of Genetic Information Production of proteins requires two steps: Transcription involves an enzyme (RNA polymerase) making an RNA copy of part of one DNA strand. Transcription involves an enzyme (RNA polymerase) making an RNA copy of part of one DNA strand. There are four main classes of RNA: i. Messenger RNAs (mRNA), which specify the amino acid sequence of a protein by using codons of the genetic code. ii. Transfer RNAs (tRNA). iii. Ribosomal RNAs (rRNA). Translation converts the information in mRNA into the amino acid sequence of a protein using ribosomes, large complexes of rRNAs and proteins. Translation converts the information in mRNA into the amino acid sequence of a protein using ribosomes, large complexes of rRNAs and proteins.

64. Steps of gene expression Transcription – DNA is read to make a mRNA in the nucleus of cells Transcription – DNA is read to make a mRNA in the nucleus of cells Translation – Reading the mRNA to make a protein in the cytoplasm Translation – Reading the mRNA to make a protein in the cytoplasm

65. Coding region: DNA that code for a specific polypeptide (protein) Promoter : DNA segment that recognizes RNA polymerase Operator: Element that serves as a binding site for an inhibitor protein (modulator) that controls transcription Three (3) regulatory elements of transcription

66. 66 Promoter Region on DNA Upstream from transcription start site Initial binding site of RNA polymerase and initiation factors (IFs) Promoter recognition: a prerequisite for initiation Prokaryotic promoter regions -10 site: “TATA” box -35 site = TTGACA

67. Promoter Region on DNA

68. Pol II Eukaryotic Promoter Elements GC box ~200 bp CCAAT box ~100 bp TATA box ~30 bp Transcription start site (TSS)

69. Pol II Eukaryotic Promoter Elements Cap Region/Signal: n C A G T n G TATA box: (~ 25 bp upstream) T A T A A A n G C C C CCAAT box: (~100 bp upstream) T A G C C A A T G GC box: (~200 bp upstream) A T A G G C G nGA

71. Prokaryotic and eukaryotic gene organization Prokaryotic transcriptional regulatory regions (promoters and operators) lie close to the transcription start site Functionally related genes are frequently located near each other These “operons” are transcribed into a single mRNA with internal translation initiation sites

72. Prokaryotic Gene Expression PromoterCistron1Cistron2CistronNTerminator TranscriptionRNA Polymerase mRNA 5’3’ Translation Ribosome, tRNAs, Protein Factors 12N Polypeptides N C N C N C 123 Expression mainly by controlling transcription

73. Operons Genes that work together are located together A promoter plus a set of adjacent genes whose gene products function together. They are controlled as a unit They usually contain 2 –6 genes (up to 20 genes) These genes are transcribed as a polycistronic transcript. It is relatively common in prokaryotes It is rare in eukaryotes

74. Operon System

75. The lactose (lac) operon Contains several elementsContains several elements –lacZ gene = β-galactosidase –lacY gene = galactosidase permease –lacA gene = thiogalactoside transacetylase –lacI gene = lac repressor –P i = promoter for the lacI gene –P = promoter for lac-operon –Q 1 = main operator –Q 2 and Q 3 = secondary operator sites (pseudo-operators ) PiP ZYA I Q3 Q1 Q2

76. Regulation of the lac operon PiP ZYA I Q3 Q1 Q2 Inducer molecules→ Allolactose: - natural inducer, degradable IPTG (Isopropylthiogalactoside) - synthetic inducer, not metabolized lacI repressor PiP ZYA I Q3 Q1 Q2 LacZLacYLacA

77. The lac operon: model for gene expression Includes three protein synthesis coding region-- sometimes called "genes" as well as region of chromosome that controls transcription of genes Genes for proteins involved in the catabolism or breakdown of lactose When lactose is absent, no transcription of gene since no need for these proteins When lactose is present, transcription of genes takes place so proteins are available to catalyze breakdown of lactose

78. Eukaryotic gene

79. Eukaryotic gene Expression 1.Transcripts begin and end beyond the coding region 2.The primary transcript is processed by: 5’ capping 3’ formation / polyA splicing 3.Mature transcripts are transported to the cytoplasm for translation

80. Regulation of gene expression Plasmid Gene (red) with an intron (green)Promoter 2. Transcription Primary transcript 1. DNA replication 3. Posttranscriptional processing 4. Translation mRNA degradation Mature mRNA 5. Posttranslational processing Protein degradation inactive protein active protein single copy vs. multicopy plasmids

81. Regulation of gene expression Gene expression is regulated—not all genes are constantly active and having their protein produced Gene expression is regulated—not all genes are constantly active and having their protein produced The regulation or feedback on gene expression is how the cell’s metabolism is controlled. The regulation or feedback on gene expression is how the cell’s metabolism is controlled. This regulation can happen in different ways: This regulation can happen in different ways: 1. Transcriptional control (in nucleus): e.g. chromatin density and transcription factors 2. Posttranscriptional control (nucleus) e.g. mRNA processing 3. Translational control (cytoplasm) e.g. Differential ability of mRNA to bind ribosomes 4. Posttranslational control (cytoplasm) e.g. changes to the protein to make it functional When regulation of gene expression goes wrong—cancer! When regulation of gene expression goes wrong—cancer!

82. 1. Transcription control

83. Eukaryotic gene expression

84. Gene regulation of the transcription Chr. I Chr. II Chr. III Condition 1 “turned on” “turned off” Condition 2 “turned off” “turned on” 123456789 101112131415161718 192021222324 2526 constitutively expressed gene induced gene repressed gene inducible/ repressible genes

85. Gene regulation constitutively expressed gene 123456789 101112131415161718 192021222324 2526 Condition 3 Condition 4 upregulated gene expression down regulated gene expression

86. Definitions Constitutively expressed genes Genes that are actively transcribed (and translated) under all experimental conditions, at essentially all developmental stages, or in virtually all cells. Inducible genes Genes that are transcribed and translated at higher levels in response to an inducing factor Repressible genes Genes whose transcription and translation decreases in response to a repressing signal Housekeeping genes – –genes for enzymes of central metabolic pathways (e.g. TCA cycle) – –these genes are constitutively expressed – –the level of gene expression may vary

87. 2. Post-Transcriptional Modification in Eukaryotes Primary transcript formed first Primary transcript formed first Then processed (3 steps) to form mature mRNA Then processed (3 steps) to form mature mRNA Then transported to cytoplasm Then transported to cytoplasm Step 1: 7- methyl-guanosine “5’-cap” added to 5’ end Step 2: introns spliced out; exons link up Step 3: Poly-A tail added to 3’ end mature mRNA 5’-cap- exons -3’ PolyA tail

88. 88 Intron Splicing in Eukaryotes Exons : coding regionsExons : coding regions Introns : noncoding regionsIntrons : noncoding regions Introns are removed by “splicing”Introns are removed by “splicing” AG at 3’ end of intron GU at 5’ end of intron

89. 89 Splicesomes Roles in Splicing out Intron RNA splicing occurs in small nuclear ribonucleoprotein particles (snRNPS) in spliceosomes

90. 90 5’ exon then moves to the 3’ splice acceptor site where a second cut is made by the spliceosome 5’ exon then moves to the 3’ splice acceptor site where a second cut is made by the spliceosome Exon termini are joined and sealed Exon termini are joined and sealed Splicesomes Roles in Splicing out Intron 12 12 1 2

91. Translation Three parts: 1.Initiation: start codon (AUG) 2.Elongation: 3.Termination: stop codon (UAG)

92. Translation P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

93. Initiation mRNA AUGCUACUUCG 2-tRNA G aa2 AU A 1-tRNA UAC aa1 anticodon hydrogen bonds codon

94. mRNA AUGCUACUUCG 1-tRNA2-tRNA UACG aa1 aa2 AU A anticodon hydrogen bonds codon peptide bond 3-tRNA GAA aa3

95. mRNA AUGCUACUUCG 1-tRNA 2-tRNA UAC G aa1 aa2 AU A peptide bond 3-tRNA GAA aa3 Ribosomes move over one codon (leaves)

96. mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU

97. mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU (leaves) Ribosomes move over one codon

98. mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5

99. mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5 Ribosomes move over one codon

100. mRNA ACAUGU aa1 aa2 U primary structure of a protein aa3 200-tRNA aa4 UAG aa5 CU aa200 aa199 terminator or stop or stop codon codon Termination

101. P SiteA Site E Site Amino Acids forming Peptide chain Ribosome tRNA anti-codon codon Translation UAC AUG Tyr GUA CAU Val mRNA strand 3’ 5’ HisMet Pro GGA CCU

102. Translation The difference Eukaryotic and prokaryotic translation can react differently to certain antibioticsEukaryotic and prokaryotic translation can react differently to certain antibiotics  Puromycin an analog tRNA and a general inhibitor of protein synthesis  Cycloheximide only inhibits protein synthesis by eukaryotic ribosomes  Chloramphenicol, Tetracycline, Streptomycin inhibit protein synthesis by prokaryotic ribosome

103. End Product The end products of protein synthesis is a primary structure of a protein. The end products of protein synthesis is a primary structure of a protein. A sequence of amino acid bonded together by peptide bonds. A sequence of amino acid bonded together by peptide bonds. aa1 aa2 aa3 aa4 aa5 aa200 aa199

104. Polyribosome incoming large subunit incoming small subunit polypeptide mRNA 1234567 Groups of ribosomes reading same mRNA simultaneously producing many proteins (polypeptides).

105. Prokaryotes vs eukaryotes: key points Prokaryotes Eukaryotes Polycistronic mRNAs (single mRNA, multiple ORFs) Monocistronic RNAs (One mRNA, one protein) Operons (functional grouping) No splicing Ribosome scanning Often spliced Regulatory sequences lie near (~100 bp) the start site Regulatory sequences can be far (>1 kb) from the start site Translation is concurrent with transcription RNA processing is concurrent with transcription; translation occurs in a separate compartment

106. TYPES OF PROTEINS Enzymes (Helicase) Enzymes (Helicase) Carrier (Haemoglobine) Carrier (Haemoglobine) Immunoglobulin (Antibodies) Immunoglobulin (Antibodies) Hormones (Steroids) Hormones (Steroids) Structural (Muscle) Structural (Muscle) Ionic (K+,Na+) Ionic (K+,Na+)

107. Coupled transcription and translation in bacteria

108. VALINE HISTIDINE LEUCINE PROLINETHREONINE GLUTAMATE VALINE original base triplet in a DNA strand As DNA is replicated, proofreading enzymes detect the mistake and make a substitution for it: a base substitution within the triplet (red) One DNA molecule carries the original, unmutated sequence The other DNA molecule carries a gene mutation POSSIBLE OUTCOMES: OR

109. A summary of transcription and translation in a eukaryotic cell A summary of transcription and translation in a eukaryotic cell