Presentation is loading. Please wait.

Presentation is loading. Please wait.

PrP polymorphisms in Korea native goats A number of polymorphisms have been described in other carprine breeds (W102G, H143R, R211Q, P240S). The results.

Similar presentations


Presentation on theme: "PrP polymorphisms in Korea native goats A number of polymorphisms have been described in other carprine breeds (W102G, H143R, R211Q, P240S). The results."— Presentation transcript:

1 PrP polymorphisms in Korea native goats A number of polymorphisms have been described in other carprine breeds (W102G, H143R, R211Q, P240S). The results of our genotypic analysis revealed comparatively high genotypic frequencies for dimorphisms identified previously at condon 143 and 240. 70% of tested all goats had Arg/Arg, His/Arg at codon 143. 66.7% of tested all goats had Pro/Pro and 30% Ser/Pro at codon 240. Some had previously reported silent polymorphisms at codon 42 and 138. No polymorphisms were detected at codon 142 and octapeptide repeat variant which has been associated with an incubation period in goats but 13.3% Trp to Gly substitution in codon 102 was found. PrP genotyping in Korean native goats NA: not applicable, *:Billin’s et al., 2002; Vaccari’s et al., 2006 Conclusions 1.The results of our genotypic analysis revealed comparatively high genotypic frequencies for dimorphisms identified previously at condon 143 and 240. 2. None of the goats in the present study carried polymorphisms at codons 142M, 222K but RR 143 or HR 143 detected high frequencies for dimorphism, which are associated with the resistance against scrapie. 3. Although the number of goats examined in the present study was relatively small, the results provide useful data about variations and distribution of the goat PrP gene, which can be used to assess the risk of scrapie in Korea. References 1. Billinis, C., Panagiotidis, C.H., Psychas, V., Argyroudis, S., Nicolaou, A., Leontides, S., Papadopoulos, O., and Sklaviadis, T. J. Gen. Virol. 2002, 83, 713-721. 2. Goldmann, W., Chong, A., Foster, J., Hope, J. and Hunter, N. T. J. Gen. Virol. 1998, 79, 3173-3176. 3. Vaccari G, Michele A, Bari D, Morelli L et. al. J.Gen. Virol 2006 87 1395-1402 Prion protein gene polymorphism in Korean native goats Hyun-Joo Sohn, Se-Young Lee, In-Soo Cho, Young-Pyo Choi, Yi-Seok Joo, Yoon-Hee Lee, Chan-Lan Kim and Dong- Seob Tark National Veterinary Research and Quarantine Service, Ministry of Agriculture and Forestry, Korea Introduction Scrapie is a TSE that causes fatal neurodegenrative disease on sheep and/or goats. It has never been reported in Republic of Korea. Polymorphism in the amino acid sequence of PrP plays a significant role in susceptibility to scrapie following exposure. In ROK, 522,534 goats (mostly Korean native goats) and 1,202 sheep were reared (MAF data, 2005). PrP amino acid polymorphisms have been described in goats, namely V21A, L23P, G49S, W102G, T110P, G127S, I142M, H143R, N146S, R154H, P168Q, R211Q, Q220H, Q222K and P240S. Only dimorphism at codon 142 was associated with an incubation period. However, another PrP variants containing only three instead of the usual five octapeptide repeats, with additional Trp to Gly substitution in codon 102 may also be associated with an increased incubation period of scrapie in goats. PrP alleles carrying Arg and His at codons 143 and 154, respectively, may offer some protection against scarpie. In addition, Lysine at codon 222 may be associated with scrapie resistance. In this study we investigated the PrP polymorphisms in Korean native goats. Materials and Methods Animals Sixty Korean native goats (Capra aegagrus hircus) for breeding purpose reared at Namwon branch of National Livestock Research Institute Genetic analysis Genomic DNA extraction isolated from heparin-treated blood (Qiagen, USA). Amplification of the PrP gene * Reference sequence : X91999 Restriction fragment length polymorphism(RFLP) - 37C overnight with Sma I or MaeII Sequncing analysis - Purification of PCR products - ABI 377automatic sequencer - Sequncing primer : sPrP-1, sPrP-2 - Analysis program : Vector NTI, Chromas Results Amino acid polymorphism PrP in goats RFLP in Korean native goats Primer5’ – 3’ Sequences* Traget geneProduct size sPrP-1 (Sense) CATCATGGTGAAAGCCACATAGGC Exon 3 coding region 794bp sPrP-2 (Antisense) GAAAACAGGAAGGTTGCCCCTATCC SusceptibilityReference Ocatapeptide repeat deletion /Gly102 Increase incubation periodGoldman et al., 1998 Ile 142 – Met 142Increase incubation periodGoldman et al., 1996 His143 – Arg 143 Arg154 – His 154 Some protectionBillinis et al., 2002 Glu 222 – Lys222Possible protective Acutis et al., 2006 Vaccari et al., 2006 Genotype Frequency No. of Natural Scrapie cases* KoreaGreece*Italy* W 102 H 143 R 211 P 240 10/60(16.7%)18/33(54.5%)16/100(16%)19/34 W 102 H 143 R 211 SP 240 6/60(10%)1/33(3.1%)3/100(3%)2/4 W 102 H 143 RQ 211 SP 240 1/60(1.7%)NA W 102 HR 143 R 211 P 240 20/60(33.3%)9/33(27.2%)18/100(18%)8/27 W 102 HR 143 R 211 SP 240 4/60(6.7%)1/33(3.1%)5/100(5%)1/6 W 102 HR 143 RQ 211 SP 240 2/60(3.3%)NA W 102 R 143 R 211 P 240 9/60(15%)4/33(12.1%)2/100(2%)0/6 WG 102 H 143 R 211 S 240 3/60(5%)NA WG 102 H 143 R 211 SP 240 1/60(1.7%)NA WG 102 HR 143 R 211 SP 240 4/60(10%)NA NameSequence Restriction codon (+)(+/-)(-) Sma ICCC!GGG36(G)19(G/A)5(A)42 Mae IIA!CGT9(Arg)30(Arg/His)21(His)143 Lengths of fragment generated by PCR products treated with restriction enzymes 143bp 651bp 427bp 794bp Frequency 102 codon Trytophan Glycine Trp/TrpTrp/GlyGly/Gly 52/60(86.7%)8/60(13.3%)0/60(0%) 143 codon Histidine Arginine His/HisHis/ArgArg/Arg 21/60(30%)30/60(55%)9/60(15%) 211 codon Arginine Glutamine Arg/ArgArg/GlnGln/Gln 57/60(95%)3/60(5%)0/60(0%) 240 codon Serine Proline Ser/SerSer/ProPro/Pro 2/60(3.3%)18/60(30%)40/60(66.7%) Silent nucleotide alteration 42 codon Pro: CCG -CCA G/GA/GA/A 36/60(60%)19/60(31.7%)5/60(8.3%) 138 codon Ser:AGC - AGT C/CC/TT/T 2/60(3.3%)19/60(31.7%)39/60(65%) Octapeptide repeat deletionNo deletion


Download ppt "PrP polymorphisms in Korea native goats A number of polymorphisms have been described in other carprine breeds (W102G, H143R, R211Q, P240S). The results."

Similar presentations


Ads by Google