Download presentation
Presentation is loading. Please wait.
Published byPatrick Haynes Modified over 8 years ago
1
1 DNA & Protein Synthesis From Gene to Protein
2
2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information (DNA).All functions of a cell are directed from some central form of information (DNA). This "biological program" is called the Genetic Code.This "biological program" is called the Genetic Code. This is the way cells store information regarding their structure and function.This is the way cells store information regarding their structure and function.
3
3 History of DNA Composition and Structure
4
4History For years the source of heredity was unknown. This was resolved after numerous studies and experimental research by the following researchers:For years the source of heredity was unknown. This was resolved after numerous studies and experimental research by the following researchers: Fredrick GriffithFredrick Griffith –He was studying effects of 2 strains of an infectious bacteria, the "smooth" strain was found to cause pneumonia & death in mice. The "rough" strain did not. He conducted the following experiment
5
5 Griffith Experiment Bacteria Strain injected into mouse Result Smooth Strain Mouse dies Rough strain Mouse Lives Heat-Killed Smooth strain Mouse lives Rough Strain & Heat killed smooth strain *MOUSE DIES* The as he predicted that the mouse should liveThe last condition was unusual, as he predicted that the mouse should live Concluded that some unknown substance was Transforming the rough strain into the smooth oneConcluded that some unknown substance was Transforming the rough strain into the smooth one
6
6 Avery, McCarty & MacLeod Was it protein or DNA? They Degraded chromosomes with enzymes that destroyed proteins or DNA The Samples with Proteins destroyed would still cause transformation in bacteria indicating genetic material was DNA Tried to determine the nature of this transforming agent.
7
7Hershey-Chase ONE virus was radioactively "tagged" with 32 P on it's DNAONE virus was radioactively "tagged" with 32 P on it's DNA The OTHER was "tagged" 35 S on it's protein coat.The OTHER was "tagged" 35 S on it's protein coat. Researchers found the radioactive P in the bacteria, indicating it is DNA, not protein being injected into bacteria.Researchers found the radioactive P in the bacteria, indicating it is DNA, not protein being injected into bacteria.
8
8 Watson & Crick The constituents of DNA had long been known. Structure of DNA, however was not.The constituents of DNA had long been known. Structure of DNA, however was not. In 1953, Watson & Crick published findings based on X-ray analysis (Rosalind Franklin) and other data that DNA was in the form of a "Double Helix".In 1953, Watson & Crick published findings based on X-ray analysis (Rosalind Franklin) and other data that DNA was in the form of a "Double Helix". Their findings show us the basic structure of DNA which is as follows.Their findings show us the basic structure of DNA which is as follows.
9
9 DNA Structure The Double Helix
10
10 DNA Structure DNA is Formed of in a "Double Helix" - like a spiral staircase
11
11Nucleotides DNA is formed by NucleotidesDNA is formed by Nucleotides These are made from three components:These are made from three components: 1.5-Carbon or pentose Sugar 2.Nitrogenous base 3. Phosphate group
12
12 Types of Nucleotides For DNA There are 4 different Nucleotides categorized as either Purines (Double rings) or Pyrimidines (Single ring). These are usually represented by a letter. They Are: 1.Adenine (A) 2.Cytosine (C) 3.Guanine (G) 4.Thymine (T) Guanine
13
13 Base Pairing Each "Rung" of the DNA "staircase" is formed by the linking of 2 Nucleotides through Hydrogen Bonds.Each "Rung" of the DNA "staircase" is formed by the linking of 2 Nucleotides through Hydrogen Bonds. These Hydrogen bonds form only between specific Nucleotides. This is known as Base Pairing. The rules are as follows:These Hydrogen bonds form only between specific Nucleotides. This is known as Base Pairing. The rules are as follows: –Adenine (A) will ONLY bond to Thymine (T) (by 2 hydrogen bonds) –Cytosine (C) will ONLY bond to Guanine (G) (by 3 hydrogen bonds)
14
14 Central Dogma of Genetics DNA to Protein Synthesis
15
15 Central Dogma of Genetics Central Dogma holds that genetic information is expressed in a specific order. This order is as followsCentral Dogma holds that genetic information is expressed in a specific order. This order is as follows There are some apparent exceptions to this. Retroviruses (eg. HIV) are able to synthesize DNA from RNA
16
16 DNA Replication DNA has unique ability to make copies of itselfDNA has unique ability to make copies of itself The process is called DNA Replication.The process is called DNA Replication. First, the enzyme Helicase unwinds the parental DNAFirst, the enzyme Helicase unwinds the parental DNA DNA "Unzips itself" by breaking the weak hydrogen bonds between base pairs forming two TEMPLATE strands with exposed NucleotidesDNA "Unzips itself" by breaking the weak hydrogen bonds between base pairs forming two TEMPLATE strands with exposed Nucleotides
17
17 DNA Replication The place where helicase attaches and opens DNA is called the Replication ForkThe place where helicase attaches and opens DNA is called the Replication Fork REPLICATION FORK
18
18 DNA Replication Helicase enzymes may attach to multiple sites on the DNA strand forming Replication Bubbles which makes replication fasterHelicase enzymes may attach to multiple sites on the DNA strand forming Replication Bubbles which makes replication faster
19
19 DNA Replication Single-strand binding proteins attach & STABILIZE the 2 parental strandsSingle-strand binding proteins attach & STABILIZE the 2 parental strands DNA polymerase attaches to the 3’ end of the 5’ to 3’ parental strandDNA polymerase attaches to the 3’ end of the 5’ to 3’ parental strand DNA polymerase attaches FREE nucleotides to the complementary nucleotide on the parental DNADNA polymerase attaches FREE nucleotides to the complementary nucleotide on the parental DNA This new strand is synthesized continuously 5’ to 3’ (LEADING)This new strand is synthesized continuously 5’ to 3’ (LEADING)
20
20 Replication Bubble Origin of Replication DNA is synthesized from the Origin of Replication within a replication bubble Towards fork – continuous replication Away from fork – discontinuous replication (fragments)
21
21 DNA Replication Since DNA polymerase can only add nucleotides to the 3’ end of the parental strand, the parental 5’ to 3’ strand must be replicated in fragments that must later be joined together (LAGGING)
22
22
23
23 DNA Replication Transcription proceeds continuously along the 5' 3' direction (This is called the leading strand)Transcription proceeds continuously along the 5' 3' direction (This is called the leading strand) Proceeds in fragments in the other direction (called the lagging strand) in the following wayProceeds in fragments in the other direction (called the lagging strand) in the following way RNA primer is attached to a segment of the strand by the enzyme primase.RNA primer is attached to a segment of the strand by the enzyme primase.
24
24 DNA Replication Transcription now continues in the 5' 3' direction forming an okazaki fragment. Until it reaches the next fragment.Transcription now continues in the 5' 3' direction forming an okazaki fragment. Until it reaches the next fragment. The two fragments are joined by the enzyme DNA ligaseThe two fragments are joined by the enzyme DNA ligase Two, new, identical DNA strands are now formedTwo, new, identical DNA strands are now formed
25
25 DNA Replication
26
26 Protein Synthesis Transcription and Translation
27
27 RNA Transcription The cell does not directly use DNA to control the function of the cell.The cell does not directly use DNA to control the function of the cell. DNA is too precious and must be kept protected within the nucleus.DNA is too precious and must be kept protected within the nucleus. The Cell makes a working "Photocopy" of itself to do the actual work of making proteins.The Cell makes a working "Photocopy" of itself to do the actual work of making proteins. This copy is called Ribonucleic Acid or RNA.This copy is called Ribonucleic Acid or RNA. RNA differs from DNA in several important ways.RNA differs from DNA in several important ways. 1.It is much smaller 2.It is single-stranded 3.It does NOT contain Thymine, but rather a new nucleotide called Uracil which will bind to Adenine 4.Contains ribose, not deoxyribose sugar
28
28 RNA Transcription RNA is produced through a process called RNA Transcription.RNA is produced through a process called RNA Transcription. RNA polymerase combines with region of DNA called a promoter (not transcribed) Small area of DNA "Unzips" exposing NucleotidesSmall area of DNA "Unzips" exposing Nucleotides RNA polymerase initiates synthesis of an RNA molecule in a 5’ to 3’direction Transcription carried out in a 5’ to 3’ direction
29
Transcription cont. This area is acted on by an enzyme called RNA Polymerase, which binds nucleotides (using uracil) to their complementary base pair.This area is acted on by an enzyme called RNA Polymerase, which binds nucleotides (using uracil) to their complementary base pair. This releases a long strand of Messenger RNA (mRNA) which is an important component ofprotein synthesis.This releases a long strand of Messenger RNA (mRNA) which is an important component of protein synthesis. 29
30
Sense and antisense strands Sense strand – coding strand (same sequence as RNA strand) Antisense strand – template strand (copied during transcription)
31
The terminator Sequence of nucleotides that causes the RNA polymerase to detach from the DNA NTPs pair with antisense strand and polymerization of the mRNA occurs Portion of transcription known as elongation
32
Post-transcription processing Within eukaryotic DNA protein- coding regions there are non-coding regions Exons – coding regions Introns – non-coding regions Introns have to be removed to make a functional mRNA strand Prokaryotic mRNA does not require processing because no introns are present
33
33 RNA Transcription
34
34 Protein Synthesis & The Genetic Code The Sequence of nucleotides in an mRNA strand determine the sequence of amino acids in a proteinThe Sequence of nucleotides in an mRNA strand determine the sequence of amino acids in a protein Process requires mRNA, tRNA & ribosomesProcess requires mRNA, tRNA & ribosomes Polypeptide chains are synthesized by linking amino acids together with peptide bondsPolypeptide chains are synthesized by linking amino acids together with peptide bonds
35
35 mRNA Each three Nucleotide sequence in an mRNA strand is called a "Codon“Each three Nucleotide sequence in an mRNA strand is called a "Codon“ Each Codon codes for a particular amino acid.Each Codon codes for a particular amino acid. The codon sequence codes for an amino acid using specific rules. These specific codon/amino acid pairings is called the Genetic Code.The codon sequence codes for an amino acid using specific rules. These specific codon/amino acid pairings is called the Genetic Code.
36
36tRNA There is a special form of RNA called Transfer RNA or tRNA.There is a special form of RNA called Transfer RNA or tRNA. Each tRNA has a 3 Nucleotide sequence on one end which is known as the "Anitcodon"Each tRNA has a 3 Nucleotide sequence on one end which is known as the "Anitcodon" This Anticodon sequence is complimentary to the Codon sequence found on the strand of mRNAThis Anticodon sequence is complimentary to the Codon sequence found on the strand of mRNA Each tRNA can bind specifically with a particular amino acid.Each tRNA can bind specifically with a particular amino acid.
37
37Ribosome Consists of two subunits made of protein & rRNAConsists of two subunits made of protein & rRNA –Large subunit –Small subunit Serves as a template or "work station" where protein synthesis can occur.Serves as a template or "work station" where protein synthesis can occur.
38
38 Protein Synthesis First, an mRNA strand binds to the large & small subunits of a ribosome in the cytosol of the cellFirst, an mRNA strand binds to the large & small subunits of a ribosome in the cytosol of the cell This occurs at the AUG (initiation) codon of the strand.This occurs at the AUG (initiation) codon of the strand. The ribosome has 3 binding sites for codons --- E (exit site), P, and A (entry site for new tRNA)The ribosome has 3 binding sites for codons --- E (exit site), P, and A (entry site for new tRNA) The ribosome moves along the mRNA strandThe ribosome moves along the mRNA strand
39
39 Protein Synthesis An anticodon on tRNA binds to a complementary codon on mRNA.An anticodon on tRNA binds to a complementary codon on mRNA. The tRNA carrying an amino acid enters the A site on the ribosomeThe tRNA carrying an amino acid enters the A site on the ribosome The ribosome moves down the mRNA so the tRNA is now in the P site and another tRNA enters the A siteThe ribosome moves down the mRNA so the tRNA is now in the P site and another tRNA enters the A site A peptide bond is formed between the amino acids and the ribosome moves down againA peptide bond is formed between the amino acids and the ribosome moves down again The first tRNA is released, and another tRNA binds next to the second, another peptide bond is formed.The first tRNA is released, and another tRNA binds next to the second, another peptide bond is formed. This process continues until a stop codon (UAG…) is reached.This process continues until a stop codon (UAG…) is reached. The completed polypeptide is then released.The completed polypeptide is then released.
40
40 Protein Synthesis
41
41
42
42 Replication Problem Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary strand?Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary strand? 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’
43
43 Answer Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary strand?Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary strand? 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’ 5’- ATGGTGCACCTGACTCCTGAGGAGAAGTCT -3’5’- ATGGTGCACCTGACTCCTGAGGAGAAGTCT -3’
44
44 RNA Transcription Problem Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary mRNA strand?Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary mRNA strand? 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’
45
45 ANSWER Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary mRNA strand?Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary mRNA strand? 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’ 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’
46
46 Codon / Anticodon Given a mRNa strand with the following nucleotide sequence, what are the sequence (anticodons) of its complimentary tRNA strands?Given a mRNa strand with the following nucleotide sequence, what are the sequence (anticodons) of its complimentary tRNA strands? 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’
47
47 Answer Given a mRNA strand with the following nucleotide sequence, what are the sequence (anticodons) of its complimentary tRNA strands? 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’ 3’ – UACCACGUGGAUGAGGACUCCUCUUCAGA -5’3’ – UACCACGUGGAUGAGGACUCCUCUUCAGA -5’
48
48 Protein Translation Given the following sequence of mRNA, what is the amino acid sequence of the resultant polypeptide?Given the following sequence of mRNA, what is the amino acid sequence of the resultant polypeptide? AUGGUGCACCUGA CUCCUGAGGAGAA GUCUAUGGUGCACCUGA CUCCUGAGGAGAA GUCU
49
49 Protein Translation / Answer Given the following sequence of mRNA, what is the amino acid sequence of the resultant polypeptide?Given the following sequence of mRNA, what is the amino acid sequence of the resultant polypeptide? AUGGUGCACCUGA CUCCUGAGGAGAA GUCUAUGGUGCACCUGA CUCCUGAGGAGAA GUCU Met-val-his-leu-thr-pro-glu-glu-lys-ser
50
50
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.