2. Environmental Influence and Genetic Technology

3. Differentiation All cells (in an organism) have the same genetic information – Except sex cells When cells differentiate during development, some genes are turned off while others are turned on – This is determined with “master control genes” – Act like conductors, directing the cell to become specific

4. Differentiation This is the process followed by stem cells – Undifferentiated cells that can differentiate into any other cell – This is how stem cell therapies could heal disease Stem cells would treat damaged tissues by replacing the damaged cells

5. Genes & Environment While some genes are controlled by master genes, other genes are turned off an on based on the cells environment

6. Norm of Reaction Varied environments create: – Range of phenotypes – Within genetic potential – Reaction with environment

7. Norm of Reaction Vestigial wings in Drosophila Curve illustrating different wing sizes in fruit flies based in temperature during development.

8. Environmental Effects on Gene Expression Himalayan markings: temperature sensitive allele Fur is usually white – When grown in cold temperatures, fur exhibits black phenotype

9. Environmental Effects on gene expression Some flowers – Sensitive to changes in pH

10. Ch. 13 Genetic TechnologyGenetic Technology What You’ll Learn You will evaluate the importance of plant and animal breeding to humans You will summarize the steps used to engineer transgenic organisms. You will analyze how mapping the human genome is benefitting human life.

11. Section Objectives Evaluate the importance of plant and animal breeding to humans. Explain a testcross.

12. We have been manipulating DNA for generations! Artificial breeding – creating new breeds of animals & new crop plants to improve our food

13. Selective Breeding From ancient times, breeders have chosen plants and animals with the most desired traits to serve as parents of the next generation. Breeders of plants and animals want to be sure that their populations breed consistently so that each member shows the desired trait. selective breeding requires time, patience, and several generations of offspring before the desired trait becomes common in a population. Increasing the frequency of desired alleles in a population is the essence of genetic technology.

14. Inbreeding develops pure lines Inbreeding is mating between closely related individuals. It results in offspring that are homozygous for most traits. To make sure that breeds consistently exhibit a trait and to eliminate any undesired traits can bring out harmful, recessive traits because there is a greater chance that two closely related individuals both may carry a harmful recessive allele for the trait. Horses and dogs are two examples of animals that breeders have developed as pure breeds.

15. Hybrids are usually bigger and better hybrid is the offspring of parents that have different forms of a trait. produced by crossing two purebred plants are often larger and stronger than their parents.

16. Test crosses can determine genotypes organisms that are either homozygous dominant or heterozygous for a trait controlled by Mendelian inheritance have the same phenotype. One way to determine the genotype of an organism is to perform a test cross. A test cross is a cross of an individual of unknown genotype with an individual of known genotype. The pattern of observed phenotypes in the offspring can help determine the unknown genotype of the parent.

17. Section Objectives: Summarize the steps used to engineer transgenic organisms. Give examples of applications and benefits of genetic engineering.

18. Genetic Engineering Genetic engineering is a faster and more reliable method for increasing the frequency of a specific allele in a population This method involves cutting — or cleaving — DNA from one organism into small fragments and inserting the fragments into a host organism of the same or a different species. You also may hear genetic engineering referred to as recombinant DNA technology Recombinant DNA is made by connecting or recombining, fragments of DNA from different sources.

19. Can we mix genes from one creature to another? YES!

20. How is this possible?? Remember: The code is universal!! Since all living organisms… – use the same DNA – use the same code book – read their genes the same way Genes can be moved from one organism to another.

21. Mixing genes for medicine… Allowing organisms to produce new proteins – bacteria producing human insulin – bacteria producing human growth hormone

22. How do we do mix genes? Genetic engineering – Locate the desired gene – cut the DNA in both organisms – paste gene from one creature into other creature’s DNA – insert new chromosome into organism – organism copies new gene as if it were its own – organism reads gene as if it were its own – organism produces NEW protein: Remember: we all use the same genetic code!

23. Recombinant DNA Enzymes are used to “cut and paste” Steps involved: Isolate a desired gene using restriction enzymes: are bacterial proteins that have the ability to cut both strands of the DNA molecule at a specific nucleotide sequence. (the scissors doing the cut) DNA ligase “ pastes ” the DNA fragments together (the glue) The result is recombinant DNA

24. Cutting DNA DNA “scissors” – enzymes that cut DNA – restriction enzymes used by bacteria to cut up DNA of attacking viruses EcoRI, HindIII, BamHI – cut DNA at specific sites enzymes look for specific base sequences GTAACGAATTCACGC TT CATTGCTTAAGTGCG AA GTAACG|AATTCACGC TT CATTGCTTAA|GTGCG AA

25. Restriction enzymes Cut DNA at specific sites – leave “sticky ends” GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA GTAACGAATTCACGC TT CATTGCTTAAGTGCG AA restriction enzyme cut site

26. Sticky ends Cut other DNA with same enzymes – leave “sticky ends” on both – can glue DNA together at “sticky ends” GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA gene you want GGACCTG AATTCCGGATA CCTGGACTTAA GGCCTAT chromosome want to add gene to GGACCTG AATTCACGCTT CCTGGACTTAA GTGCGAA combined DNA

27. Sticky ends help glue genes together TTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCA CGCTT AACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGT GCGAA gene you wantcut sites AATGGTTACTTGTAACG AATTCTACGATCGCCGATTCAACGCTT TTACCAATGAACATTGCTTAA GATGCTAGCGGCTAAGTTGCGAA chromosome want to add gene tocut sites AATTCTACGAATGGTTACATCGCCG GATGCTTACCAATGTAGCGGCTTAA isolated gene sticky ends chromosome with new gene added TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACG ATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATG CTAGC sticky ends stick together DNA ligase joins the strands Recombinant DNA molecule

28. Why mix genes together? TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACG ATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATG CTAGC Gene produces protein in different organism or different individual aa “new” protein from organism ex: human insulin from bacteria human insulin gene in bacteria bacteriahuman insulin

29. Uses of genetic engineering Genetically modified organisms (GMO) – enabling plants to produce new proteins Protect crops from insects: BT corn – corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn) Extend growing season: fishberries – strawberries with an anti-freezing gene from flounder Improve quality of food: golden rice – rice producing vitamin A improves nutritional value

30. Vectors transfer DNA vector is the means by which DNA from another species can be carried into the host cell. may be biological or mechanical. Biological vectors include viruses and plasmids. – A plasmid, is a small ring of DNA found in a bacterial cell. Plasmids

31. Vectors transfer DNA Two mechanical vectors carry foreign DNA into a cell ’ s nucleus One, a micropipette, is inserted into a cell; the other is a microscopic metal bullet coated with DNA that is shot into the cell from a gene gun.

32. Bacteria Bacteria are great! – one-celled organisms – reproduce by mitosis easy to grow, fast to grow – generation every ~20 minutes

33. There’s more… Plasmids – small extra circles of DNA – carry extra genes that bacteria can use – can be swapped between bacteria rapid evolution = antibiotic resistance – can be picked up from environment

34. How can plasmids help us? A way to get genes into bacteria easily – insert new gene into plasmid – insert plasmid into bacteria = vector – bacteria now expresses new gene bacteria make new protein + transformed bacteria gene from other organism plasmid cut DNA recombinant plasmid vector glue DNA

35. Grow bacteria…make more grow bacteria harvest (purify) protein transformed bacteria plasmid gene from other organism + recombinant plasmid vector

36. Gene cloning Bacteria take the recombinant plasmids and reproduce This clones the plasmids and the genes they carry Clones are genetically identical copies. – Products of the gene can then be harvested The process of cloning a human gene in a bacterial plasmid can be divided into six steps. 1..Isolate DNA from two sources 2.Cut both DNAs with the same restriction enzyme 3. Mix the DNAs; they join by base-pairing 4.Add DNA ligase to bond the DNA covalently 5. Put plasmid into bacterium 6.Clone the bacterium Recombinant DNA plasmid Human cell Plasmid Bacterial clones carrying many copies of the human gene

37. Cloning of animals You have learned about gene cloning Scientists are perfecting the technique for cloning animals

38. Applications of biotechnology

39. Applications of DNA Technology Recombinant DNA in industry Many species of bacteria have been engineered to produce chemical compounds used by humans. Scientists have modified the bacterium E. coli to produce the expensive indigo dye that is used to color denim blue jeans. The production of cheese, laundry detergents, pulp and paper production, and sewage treatment have all been enhanced by the use of recombinant DNA techniques that increase enzyme activity, stability, and specificity. Production of renewable fuel sources is aided by bacterial digestion of cellulose materials

40. Applications of DNA Technology Recombinant DNA in medicine Pharmaceutical companies already are producing molecules made by recombinant DNA to treat human diseases. Recombinant bacteria are used in the production of human growth hormone and human insulin –This lab equipment is used to produce a vaccine against hepatitis B

41. Applications of DNA Technology Recombinant DNA in agriculture Crops have been developed that are better tasting, stay fresh longer, and are protected from disease and insect infestations. “ Golden rice” has been genetically modified to contain beta-carotene

42. Could GM organisms harm human health or the environment? Genetic engineering involves some risks – Possible ecological damage from pollen transfer between GM and wild crops Weeds could also become more drought tolerant, or herbicide resistant – Pollen from a transgenic variety of corn that contains a pesticide may stunt or kill monarch caterpillars

43. Polymerase chain reaction (PCR) method is used to amplify DNA sequences The polymerase chain reaction (PCR) can quickly clone a small sample of DNA in a test tube Number of DNA molecules Initial DNA segment

44. The PCR method is used to amplify DNA sequences The polymerase chain reaction (PCR) can quickly clone a small sample of DNA in a test tube Advantages of PCR Can amplify DNA from a small sample Results are obtained rapidly Reaction is highly sensitive, copying only the target sequence Repeated cycle of steps for PCR Sample is heated to separate DNA strands Sample is cooled and primer binds to specific target sequence Target sequence is copied with heat-stable DNA polymerase

45. 2006-2007 Biotechnology Gel Electrophoresis

46. Many uses of restriction enzymes… Now that we can cut DNA with restriction enzymes… – we can cut up DNA from different people… or different organisms… and compare it – why? forensics medical diagnostics paternity evolutionary relationships and more…

47. Comparing cut up DNA How do we compare DNA fragments? – separate fragments by size How do we separate DNA fragments? – run it through a gelatin – gel electrophoresis How does a gel work?

48. Gel Electrophoresis longer fragments shorter fragments power source completed gel gel DNA & restriction enzyme wells - +

49. Gel electrophoresis A method of separating DNA in a gelatin-like material using an electrical field – DNA is negatively charged – when it’s in an electrical field it moves toward the positive side + – DNA        “swimming through Jello”

50. Running a gel 12 cut DNA with restriction enzymes fragments of DNA separate out based on size 3 Stain DNA – ethidium bromide binds to DNA – fluoresces under UV light

51. Gel Electrophoresis- sorts DNA molecules by size Separation technique: separates DNA by size and charge 1.Restriction enzymes – cut DNA I into fragments 2. The gel – “Wells” made at one end. Small amounts of DNA are placed in the wells 3. The electrical field gel placed in solution and an electrical field set up with one neg. (-) & one pos. (+) end 4. The fragments move negatively charged DNA fragments travel toward positive end. The smaller fragments move faster, larger particles move more slowly. Mixture of DNA molecules of different sizes Gel Longer molecules Shorter molecules Power source

52. DNA fingerprint Why is each person’s DNA pattern different? – sections of “junk” DNA doesn’t code for proteins made up of repeated patterns – CAT, GCC, and others – each person may have different number of repeats many sites on our 23 chromosomes with different repeat patterns GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA GCTTGTAACGGCATCATCATCATCATCATCCGGCCTACGC TT CGAACATTGCCGTAGTAGTAGTAGTAGTAGGCCGGATGC GAA

53. Uses: Forensics Comparing DNA sample from crime scene with suspects & victim – + S1 DNA  S2S3V suspects crime scene sample

54. Electrophoresis use in forensics Evidence from murder trial – Do you think suspect is guilty? “standard” blood sample 3 from crime scene “standard” blood sample 1 from crime scene blood sample 2 from crime scene blood sample from victim 2 blood sample from victim 1 blood sample from suspect OJ Simpson N Brown R Goldman

55. Uses: Paternity Who’s the father? + DNA  childMomF1F2 –

56. Uses: Evolutionary relationships Comparing DNA samples from different organisms to measure evolutionary relationships – + DNA  13245 12345 turtlesnakeratsquirrelfruitfly

57. Uses: Medical diagnostic Comparing normal allele to disease allele chromosome with disease-causing allele 2 chromosome with normal allele 1 – + allele 1 allele 2 DNA  Example: test for Huntington’s disease

58. Diagnosis of genetic disorders The DNA of people with and without a genetic disorder is compared to find differences that are associated with the disorder. Once it is clearly understood where a gene is located and that a mutation in the gene causes the disorder, a diagnosis can be made for an individual, even before birth. Single nucleotide polymorphism (SNP) is a variation at one base pair within a coding or noncoding sequence Scientists hypothesize that SNP s may help identify different types of genetic disorders

59. Diagnosing Genetic Disorders – Amniocentesis- physicians remove a small amount of amniotic fluid from the placenta. A karyotype can be made from this fluid to check for possible disorders.

60. Chorion villi sampling- physician analyzes a sample of the chorion villi, which grows between the uterus and the placenta. The villi will have the same DNA as the baby.

61. Mapping and Sequencing the Human Genome In February of 2001, the HGP published its working draft of the 3 billion base pairs of DNA in most human cells. The Human Genome Project involves: – genetic and physical mapping of chromosomes – DNA sequencing – comparison of human genes with those of other species

62. Sequencing the human genome The difficult job of sequencing the human genome is begun by cleaving samples of DNA into fragments using restriction enzymes. Then, each individual fragment is cloned and sequenced. The cloned fragments are aligned in the proper order by overlapping matching sequences, thus determining the sequence of a longer fragment.

63. The Human Genome Project revealed that most of the human genome does not consist of genes Results of the Human Genome Project Humans have 21,000 genes in 3.2 billion nucleotide pairs Only 1.5% of the DNA codes for proteins, tRNAs, or rRNAs The remaining 88.5% of the DNA contains: – Control regions such as promoters and enhancers – Unique noncoding DNA – Repetitive DNA

64. Applications of the Human Genome Project Improved techniques for prenatal diagnosis of human disorders, – use of gene therapy, – development of new methods of crime detection are areas currently being researched. – diagnosis of genetic disorders.

65. Gene therapy the insertion of normal genes into human cells to correct genetic disorders. – Progress is slow, however – There are also ethical questions related to gene therapy

66. Proteomics is the scientific study of the full set of proteins encoded by a genome – Proteomics –Studies the proteome, the complete set of proteins specified by a genome –Investigates protein functions and interactions – The human proteome may contain 100,000 proteins – Genomics The study of an organism’s complete set of genes and their interactions Copyright © 2009 Pearson Education, Inc.