1. Ian Barr Feigon Lab, UCLA Chemistry Progress report: Shq1-CS domain; TER Stem Loop IV

2. Projects: Over expression and Purification of Full length Shq1 Over expression and Purification of Shq1 CS Domain Crystallization of Shq1-CS domain Preparation of Stem Lop IV RNA for p65 Binding studies.

3. Shq1 Found to associate with Naf1, forming a complex necessary for H/ACA snoRNA production. These are involved in rRNA processing 507 a.a. long. Shows good dispersion in 1D NMR spectra The CS domain is a protein-protein interaction domain.

4. Various Shq1 constructs Entire protein too large for NMR studies. CS domain is the proper size, and shows good dispersion in HSQC spectra. Picture from M. Singh

5. Shq1-CS domain HSQC Total number of amino acids in Shq1-CS term is 115: including 4 Pro and His-tag residues Number of peaks in HSQC are: ~95 (Slide from Mahavir)

6. Shq1 and Shq1-CS over-expression His-tagged Shq1-CS and GST-tagged Shq1 were over expressed by transformation of competent cells and growth in 2L broth. Cells were then lysed by sonication. Extract was run through affinity column, then size exclusion. Crude pre A9 A10 A11 A13 B3 B5 Shq1 - FL Post SEC Shq1-CS Post Ion-ex Crude Flow X1 X2 X3 A9 A10 A11

7. Cleavage of GST Tag with enterokinase Time(hrs): 0 1 3 6 12 24 20 mM Tris- HCl 50 mM NaCl pH 7.2

8. Crystallization Trials His-tagged Shq1-CS 144 conditions: Index 1-96, PEG Ion 1-48 Used Sitting drop Method, 8mg/mL Shq1-CS Most crystals appeared within a week In general, PEG conditions gave the best results.

9. Crystals of Shq1-CS domain Index 65 PEG 7 PEG 7: 0.2 M CaCl 2 20% PEG pH 5.1 Index 65: 0.1 M NH 4 Ac 0.1 BIS-TRIS, pH 5.5 17% PEG

10. Future Directions Crystallize the Shq1-CS domain and diffract to higher resolution.(Currently ~3Å) Express the Full-length Shq1 and cleave the GST tag (or use His tag).

11. P65 and Stem loop IV Stem Loop IV is a segment of TER. It was shown by Richards et al. Stem Loop IV has a rigid 50˚bend at the GA bulge. Deletion of GA bulge decreases RNP assembly. GA bulge Stem Loop IV P65 is a 542 a.a. protein with a putative RRM (RNA Recognition Motif)

12. Goals of this project To prepare Stem Loop IV and Stem IV for for co-crystallization, NMR, and/or Binding studies with p65. To characterize the association between p65 and Stem-Loop IV.

13. Overview of Stem loop preparation Synthesis of SL-IV and S-IV template DNA. Purification Transcription of SL-IV and S-IV Purification and concentration to appropriate levels.

14. Oligos Used SL-IV GGGACATCCATTGATAAATAGTGTATCAA ATGTCGATGTCCCTATAGTGAGTCGTATT AG S-IV GGTCCATCCGAAGATGTCGACCTATAGTG ACTCGTATTA 5’ T7 Prom.

15. S-IV and SL-IV Both contain the GA bulge recognized by p65. Modified from wild type to contain GG at 5´end for ease of transcription. S-IV consists of the Boxed region of SL-IV. Structures predicted by MFold SL-IV Mw: 13,377 Da Length: 42 nt. S-IV Mw: 7033 Da Length: 22 nt

16. S-IV Transcription Trials (100  L) Template Varying Mg 2+ and PEG concentration, found best transcription at 20mM Mg 2+, 4mM NTP's, 4% PEG; scaled up to 15mL. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 S-IV PEG 0 | 8 | 16 | 4 | 2  L

17. S-IV at 10˚C 1D 1 H NMR The S-IV construct at pH 7; In 50mM KCl, 20 mM KH 2 PO 4 Conc: 0.183mM

18. 10˚C 15˚C 20˚C 25˚C 30˚C 1D 1 H NMR 500MHz The S-IV construct at pH 7; 50mM KCl,20 mM K 2 H 2 PO 4 Conc: 0.183mM

19. Future Work Re-transcribe S-IV, SL-IV in greater amounts Show p65 binding through gel-shift assay/NMR Crystallization of p65/SL-IV complex

20. Acknowledgements The Feigon Lab, especially Mahavir Singh, Nak-Kyoon Kim, and Nick Chim.

21. References Darzacq, X et al. (2006) Journal of Cell Biology, 173, 207 Richards, RJ. et al. (2006) RNA 12,1475 Yang et al. (2002) J. Biol. Chem. 277, 45235