1. Biopython

2. biopython http://biopython.org/wiki/Biopython http://biopython.org/DIST/docs/tutori al/Tutorial.html http://www.biosql.org/wiki/Main_Page

3. Sequences and Alphabets Bio.Seq, Bio.Alphabet Specify alphabet whenever you can s=Seq('AGTAAAGCT',IUPAC.protein) print s.alphabet Sequences act like strings – print s[0:3] – print len(s)

4. Sequence Operations complement() reverse_complement() transcribe() translate()

5. SeqRecord object SeqRecord – seq – id – name – description Bio.SeqIO.read() can read fasta files and return SeqRecord objects >>> SeqIO.read("NC_005816.fna", "fasta") SeqRecord( seq=Seq('TGTAACGAACGGTGCAATAGTGATCCACACCCAACGCCT GAAATCAGATCCAGG...CTG', SingleLetterAlphabet()), id='gi|45478711|ref|NC_005816.1|', name='gi|45478711|ref|NC_005816.1|', description='gi|45478711|ref|NC_005816.1| Yersinia pestis biovar Microtus... sequence', dbxrefs=[])

6. Entrez PubMed, Medline GEO (Gene Expression Omnibus) UniGene Example: from Bio import Entrez, SeqIO handle = Entrez.efetch(db="nucleotide", rettype="fasta", id="6273291", email='none@example.com') rec = SeqIO.read(handle, "fasta") handle.close() print rec.id,': ',rec.seq