1. DNA, RNA & Protein Synthesis

2. What is DNA? The hereditary material in the nucleus of cells that tells the cell when to make proteins and what proteins it should make. DNA is found on chromosomes. Regions of DNA that code for proteins are called genes. These proteins give organisms their traits, such as eye color. DNA stands for deoxyribonucleic acid.

4. DNA Structure Discovered in 1953 by James Watson and Francis Crick. DNA is a double-helix = 2 strands twisted around each other like a spiral staircase. DNA is made of repeating subunits called nucleotides. Nucleotides have 3 parts: –Deoxyribose sugar –Nitrogen base –Phosphate group

5. DNA Nucleotide

6. DNA Structure continued… The sides of the DNA ladder are repeating phosphates and sugars. The steps of the ladder are the nitrogen bases. There are 4 different nitrogen bases in DNA: –Adenine –Guanine –Cytosine –Thymine Purines = Have a double ring structure Pyrimidines = Have a single ring structure

7. Nitrogen Bases in DNA

8. Complementary Base Pairing Watson and Crick discovered that the following base pairing rule exists in DNA structure: –Adenine is complementary (fits together) with Thymine Held together by 2 hydrogen bonds –Cytosine is complementary with Guanine Held together by 3 hydrogen bonds Each pairing includes one purine and one pyrimidine.

9. Label the small portion of DNA shown below: Label and color the following: Sugars (red) Phosphates (green) Nitrogen bases C (purple) G (orange) A (blue) T (yellow) Hydrogen bonds

10. If the sequence of half of a DNA strand is TAGGCC, draw the entire DNA strand. Label a phosphate group, deoxyribose sugar, all nitrogen bases, and a hydrogen bond.

11. Build a DNA Model Black= sugar White hollow= phosphate White solid= hydrogen bond Blue= cytosine Green= thymine Orange= adenine Yellow= guanine ½ of the DNA has the sequence CTGGACT

12. Strawberry DNA Extraction 10 ml

13. Strawberry DNA Extraction cont..

14. Replication During interphase, chromosomes create new chromatids. This process of making new DNA strands is called replication. This process happens in the nucleus of the cell. Each new DNA produced has ½ from the original strand and ½ that is newly built. DNA helicase unwinds the DNA and breaks the hydrogen bonds that hold the 2 strands of DNA together. DNA polymerase forms the new halves of DNA by putting the correct nucleotides into position. It also proofreads the new DNA built for any errors. This process occurs once in a cell’s lifetime- right before it divides.

16. Below is a strand of DNA. If the strand of DNA goes through 2 rounds of replication, draw the 4 resulting DNA molecules. Newly built DNA halves are represented by a dotted line.

17. Transcription Transcription is the making of RNA by using the DNA code as a template. RNA is single stranded so only ½ of the DNA is used as a template. This half is called the sense strand. The other is the non-sense strand. RNA polymerase starts at a promoter on the DNA and builds the new strand of RNA until it reaches a termination signal. RNA produced leaves the nucleus through nuclear pores (openings in the membrane) to enter the cytoplasm. Why can it leave? 3 types of RNA are produced: messenger RNA (mRNA), ribosomal RNA (rRNA) and transfer RNA (tRNA)

18. Contrasting DNA and RNA DNA 2 strands Deoxyribose sugar Remains in the nucleus Bases –ATCG A pairs with T G pairs with C RNA 1 strand Ribose sugar Exits nucleus Bases –AUGC A pairs with U G pairs with C

20. Review Question Draw a DNA model with the sequence TGCCACTG and label all parts. The side of the DNA listed above is the sense strand. If the promoter is after the 1 st “T” and the termination signal is before the last “T”, what is the sequence of the RNA strand produced?

21. 3 Types of RNA 1.mRNA (messenger)- carries the DNA’s instructions for making proteins out of the nucleus to the ribosomes in the cytosol. Every 3 nucleotides on mRNA is called a codon. Each codon codes for an amino acid. –See codon table

23. 2.tRNA (transfer)- carries a specific amino acid on one end and an anticodon on the other end. The anticodon complements the codon on mRNA. Draw the tRNA structure: 3. rRNA (ribosomal)- Along with protein, this makes up the structure of a ribosome.

24. Translation (Protein Synthesis) 1. mRNA leaves the nucleus and enters the cytosol. 2. mRNA attaches to a ribosome. 3. At the start codon (AUG), a tRNA brings its amino acid into position. 4.Adjacent amino acids bond together with a peptide bond and the tRNA leaves. 5.The ribosome then moves onto the next codon. 6. This process continues until the STOP codon is reached. 7. The new protein is released.

25. Draw the translation process The sense strand of DNA is TACGCCCTGAAAATT (promoter and termination signals are at the ends)

27. What is the protein product for a sense strand with the following sequence? TACTTTGACAGCCCCGTTATC

31. Cell Differentiation All human somatic cells (non-sex) have the same genetic material. –Then how do we have 220 cells types that look and function differently? Cell differentiation (specialization) occurs when genes (segments of DNA that code for proteins) do not experience transcription (turned into RNA) or translation (RNA turned into protein) because the cell turns off the gene. This means that differentiated cells have the ability to behave like any other cell if given the right gene regulations.

32. Gene Mutations Mutation- A change in the DNA sequence of a gene. –Rare –Are mutations passed on to offspring? Only if the mutation is in a gamete (sex cell)! –Point mutations are changes in one or a few nucleotides in a gene. Substitution= When 1 nucleotide is substituted for another (A in place of C). Addition= When 1 (or a few) nucleotide(s) is added to the sequence Deletion= When 1 (or a few) nucleotide(s) is deleted from the sequence.

33. Indicate how the following point mutation would affect the resulting protein. DNA sequence of sense strand: (promoter)TACGTTCATGGGATT (term. signal) What is the mRNA? What is the amino acid sequence?

34. TACGTTCATGGGATT What is the amino acid sequence if the first “G” was deleted?

35. DNA code TGA ______________ _______________ mRNA codon _____________ UCU_______________ tRNA anticodon _____________ _______________________________ Amino acid ____________ ______________ tryptophan

36. DNA code CAT ______________ _______________ mRNA codon _____________ GUU_______________ tRNA anticodon _____________ _______________________________ Amino acid ____________ ______________ methionine