Presentation is loading. Please wait.

Presentation is loading. Please wait.

How Genes Work: From DNA to RNA to Protein Chapter 17.

Similar presentations


Presentation on theme: "How Genes Work: From DNA to RNA to Protein Chapter 17."— Presentation transcript:

1 How Genes Work: From DNA to RNA to Protein Chapter 17

2

3

4 Figure 17.6 (a) Tobacco plant expressing a firefly gene gene (b) Pig expressing a jellyfish

5

6

7 Types of RNA

8 Steps to Proteinsynthesis 1.Transcription- DNA to mRNA 2.RNA Processing- remove noncoding segments 3.Translation- mRNA to tRNA to Amino Acid Sequence

9 Complementary Base Pairing A=UT=AC=GG=CA=UT=AC=GG=C DNA Nitrogen Bases RNA Nitrogen Bases The code travels from DNA to mRNA to tRNA to protein.

10 Complementary Base Pairing A=UU=AC=GG=CA=UU=AC=GG=C mRNA Nitrogen Bases tRNA Nitrogen Bases The code travels from DNA to mRNA to tRNA to protein.

11 Figure 17.4 DNA template strand TRANSCRIPTION mRNA TRANSLATION Protein Amino acid Codon Trp Phe Gly 5 5 Ser UUUUU 3 3 5 3 G G GGCC T C A A AAAAA TTT T T G GGG CCC GG DNA molecule Gene 1 Gene 2 Gene 3 C C

12 Figure 17.3b-1 Nuclear envelope DNA Pre-mRNA (b) Eukaryotic cell TRANSCRIPTION

13 Figure 17.3b-2 RNA PROCESSING Nuclear envelope DNA Pre-mRNA (b) Eukaryotic cell mRNA TRANSCRIPTION

14 Figure 17.3b-3 RNA PROCESSING Nuclear envelope DNA Pre-mRNA (b) Eukaryotic cell mRNA TRANSCRIPTION TRANSLATION Ribosome Polypeptide

15

16 Initiation Complex Single binding protein Replication Fork Initiation Complex Initiation Complex

17 RNA Polymerase 5’ 3’ 5’ 3’ 5’ 3’ Promoter Terminator RNA Polymerase Initiation Complex Initiation Complex

18 Pre-mRNA DNA recoils

19

20

21 Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Figure 17.10 RNA processing: RNA splicing TRANSCRIPTION RNA PROCESSING DNA Pre-mRNA mRNA TRANSLATION Ribosome Polypeptide 5 Cap Exon Intron 1 5 30 31 Exon Intron 104105146 Exon 3 Poly-A tail Introns cut out and exons spliced together Coding segment 5 Cap 1 146 3 UTR Pre-mRNA mRNA

22 Figure 17.12-1 RNA transcript (pre-mRNA) 5 Exon 1 Protein snRNA snRNPs Intron Exon 2 Other proteins

23 Figure 17.12-2 RNA transcript (pre-mRNA) 5 Exon 1 Protein snRNA snRNPs Intron Exon 2 Other proteins Spliceosome 5

24 Figure 17.12-3 RNA transcript (pre-mRNA) 5 Exon 1 Protein snRNA snRNPs Intron Exon 2 Other proteins Spliceosome 5 Spliceosome components Cut-out intron mRNA 5 Exon 1 Exon 2

25

26 Gene DNA Exon 1 Exon 2Exon 3 Intron Transcription RNA processing Translation Domain 3 Domain 2 Domain 1 Polypeptide Figure 17.13

27 Figure 17.14 Polypeptide Ribosome Trp Phe Gly tRNA with amino acid attached Amino acids tRNA Anticodon Codons UUUUGGGGC A C C C C G AAA C G C G 5 3 mRNA

28 Figure 17.15 Amino acid attachment site 3 5 Hydrogen bonds Anticodon (a) Two-dimensional structure (b) Three-dimensional structure (c) Symbol used in this book Anticodon 3 5 Hydrogen bonds Amino acid attachment site 5 3 AAG

29 Aminoacyl-tRNA synthetase (enzyme) Amino acid PPP Adenosine ATP Figure 17.16-1

30 Aminoacyl-tRNA synthetase (enzyme) Amino acid PPP Adenosine ATP P P P P P i i i Adenosine Figure 17.16-2

31 Aminoacyl-tRNA synthetase (enzyme) Amino acid PPP Adenosine ATP P P P P P i i i Adenosine tRNA Adenosine P tRNA AMP Computer model Amino acid Aminoacyl-tRNA synthetase Figure 17.16-3

32 Aminoacyl-tRNA synthetase (enzyme) Amino acid PPP Adenosine ATP P P P P P i i i Adenosine tRNA Adenosine P tRNA AMP Computer model Amino acid Aminoacyl-tRNA synthetase Aminoacyl tRNA (“charged tRNA”) Figure 17.16-4

33 Figure 17.17b Exit tunnel A site (Aminoacyl- tRNA binding site) Small subunit Large subunit P A P site (Peptidyl-tRNA binding site) mRNA binding site (b) Schematic model showing binding sites E site (Exit site) E

34 Figure 17.17c Amino end mRNA E (c) Schematic model with mRNA and tRNA 5 Codons 3 tRNA Growing polypeptide Next amino acid to be added to polypeptide chain

35 Figure 17.18 Initiator tRNA mRNA 5 5 3 Start codon Small ribosomal subunit mRNA binding site 3 Translation initiation complex 5 3 3 U U A A G C P P site i  GTPGDP Met Large ribosomal subunit EA 5

36 Amino end of polypeptide mRNA 5 E P site A site 3 Figure 17.19-1

37 Amino end of polypeptide mRNA 5 E P site A site 3 E GTP GDP  P i P A Figure 17.19-2

38 Amino end of polypeptide mRNA 5 E P site A site 3 E GTP GDP  P i P A E P A Figure 17.19-3

39 Amino end of polypeptide mRNA 5 E A site 3 E GTP GDP  P i P A E P A GTP GDP  P i P A E Ribosome ready for next aminoacyl tRNA P site Figure 17.19-4

40 Figure 17.20-1 Release factor Stop codon (UAG, UAA, or UGA) 3 5

41 Figure 17.20-2 Release factor Stop codon (UAG, UAA, or UGA) 3 5 3 5 Free polypeptide 2 GTP 2 GDP  2 i P

42 Figure 17.20-3 Release factor Stop codon (UAG, UAA, or UGA) 3 5 3 5 Free polypeptide 2 GTP 5 3 2 GDP  2 i P

43

44 mRNA Codon Chart DNA – T A C G G G T C G A T A A T T mRNA – A U G C C C A G C U A U U A A AA Sequence – Met-Pro-Ser-Tyr-Stop

45 DNA = AGCTTACGGGATAACTCCC mRNA = AUGCCCUAUUGA Met-Pro-Tyr-Stop

46

47 BIOLOGY PRACTICE PROTEINSYNTHESIS 3’ ACGGCTACGGGCTTCGAAAAACTCACACA 5’ 5’ ACACAATTAGGATCCAAACATCACTGGAC 3’

48 BIOLOGY PRACTICE PROTEINSYNTHESIS 3’ ACGGCTACGGGCTTCGAAAAACTCACACA 5’ 5’ AUGCCCGAAGCUUUUUGAGUGUGU3’ Met-Pro-Glu-Ala-Phe-Stop 5’ ACACAATTAGGATCCAAACATCACTGGAC 3’ 3’ UGUGUUAAUCCUAGGUUUGUA 5’ Met-Phe-Gly-Ser-Stop

49 Figure 17.5 Second mRNA base First mRNA base (5 end of codon) Third mRNA base (3 end of codon) UUU UUC UUA CUU CUC CUA CUG Phe Leu Ile UCU UCC UCA UCG Ser CCU CCC CCA CCG UAU UAC Tyr Pro Thr UAA Stop UAG Stop UGA Stop UGU UGC Cys UGG Trp GC U U C A U U C C C A U A A A G G His Gln Asn Lys Asp CAU CGU CAC CAA CAG CGC CGA CGG G AUU AUC AUA ACU ACC ACA AAU AAC AAA AGU AGC AGA Arg Ser Arg Gly ACGAUG AAG AGG GUU GUC GUA GUG GCU GCC GCA GCG GAU GAC GAA GAG Val Ala GGU GGC GGA GGG Glu Gly G U C A Met or start UUG G

50 Figure 17.21 Completed polypeptide Incoming ribosomal subunits Start of mRNA (5 end) End of mRNA (3 end) (a) Polyribosome Ribosomes mRNA (b) 0.1  m Growing polypeptides

51

52 Gene Mutations Changes in the base sequence of a single gene

53 Point Mutation Mutation involving the substitution of one base.

54

55 NormalSickle

56 Frameshift Mutation Mutation involves a change in the reading frame of the codon. Example: Deletion

57

58

59 The Rock Pocket Mouse

60


Download ppt "How Genes Work: From DNA to RNA to Protein Chapter 17."

Similar presentations


Ads by Google