1. Molecular epidemiology of MRSA Epidemic and pandemic clones circulation in Romania Professor Lia Monica Junie Professor Lia Monica Junie, University of Medicine and Pharmacy, Cluj Napoca, Romania

2. Why Staphylococcus aureus?

4. Antibiotic resistance in S. aureus Gasch O & all, “Methicillin-susceptible Staphylococcus aureus clone related to the early pandemic phage type 80/81 causing an outbreak among residents of three occupational centers in Barcelona, Spain. Clin Microbiol Infect. 2012;18(7): 662-7.

5. The Antibiotic resistance in S. aureus the blaZ gene, encoding for β-lactamase → resistant clones to the penicillin

6. Methicillin-resistant Staphylococcus aureus mecA Gene (the methicillin-resistance determinant) encodes PBP2a

7. site-specific recombinase SCCmec The staphylococcal cassette - SCCmec SCCme - types I, II, III, IV Antimicrob Agents Chemother 2004; 48: 2637–2651

8. SCCmec types I, II, III,IV SCCmec types I, II, III,IV

9. Methicillin-Resistant S. aureus (MRSA)

10. MRSA - Hospital acquired infections

11. Global spread of MRSA

12. Worldwide prevalence of MRSA

13. MRSA epidemic clones five pandemic MRSA clones

14. EMRSA16 SCCmec type II, enterotoxin A,TSST-1, resistant to Erythromycin, Ciprofloxacin Pandemic MRSA clones

15. New epidemic clones Evolution of the antibiotic resistance in ST5

17. CA & HA-MRSA toxin & the AB resistance the presence of PVL toxin & the AB resistance Panton-Valentine leukocidin (PVL) - a major virulence factors of S. aureus

18. The emergence of the HA & CA-MRSA

19. The genom of CA-MRSA Vandenesch F. and all "Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: worldwide emergence” Emerg Infect Dis 9 (8): 978–84, 2003.

20. Panton–Valentine leukocidin - PVL Wolk D M et al. J. Clin. Microbiol. 2009;47:3129-3137

21. New PVL Positive EMRSA Clones Vandenesch F & all, "Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: worldwide emergence”. Emerg Infect Dis 9 (8): 978–84. 2007

22. CA-MRSA strains from other continents Anne Tristan et all “Global Distribution of Panton-Valentine Leukocidin–positive Methicillin-resistant Staphylococcus aureus”, Emerg Infect Dis. 2007; 13(4): 594–600. some PVL-positive CA-MRSA have spread to several countries on various continents.

23. The agr system of Staphylococcus aureus the agr locus - accessory gene regulator Deresinski S "Methicillin-resistant Staphylococcus aureus: an evolutionary, epidemiologic, and therapeutic odyssey". Clin. Infect. Dis. 40 (4): 562–573, 2005.

24. S. aureus agr groups S. aureus strains can be divided into 4 major agr groups (I – IV)

25. Staphylococcus enterotoxins (SEs) 19 different enterotoxins (Ses): SEA, SEB, SEC, SED, SEE. new types of SEs (SEG, SEH, SEI, SEJ, SEK, SEL, SEM, SEN, and SEO)

26. Staphylococcus aureus pathogenicity islands carrying enterotoxin genes

27. Research objectives Detection of the genes content of S. aureus strains isolated from hospitals by PCR : – mecA gene >> MRSA – pathogenity genes : TSST, PVL, agr, enterotoxin (sem & seg) S. aureus genes prevalence in Romanian hospitals Correlation: genes and AB resistance phenotypes

28. Materials and Methods S. aureus strains – patients (medical, surgical, intensive care units) from 2 University hospitals

29. S. aureus strains identification & Antibiotic Susceptibility Testing API ID 32 Staph the AB resistance to  -lactamins, Kanamycin, tobramycin, gentamicin, Erythromycin, Clindamycin, Ciprofloxacin, Fusidic Acid, Glycopeptides. Vitek2 system

30. PRIMER nucleotidic sequence MecA:Forward primer (5 AAA TCA GAT GGT AAA GGT TGG C3) Reverse primer (5 AGT TCT GCA GTA CCG GAT TTG C3) * Multiplex PCR (mecA and PVL gene); University Hospital of Patras (Prof. Iris Spiliopoulou, Prof Evangelos D Anastassiou) PCR in the Detection of S. aureus genes content * mecA & PVL gene agr specific group

31. GenePrimerSequence (5′→3′)Amplicon size (bp) segSeg-FCCACCTGTTGAAGGAAGAGG432 semSem-FCTATTAATCTTTGGGTTAATGGAGAAC300 tsstTSST-FTGCAAAAGCATCTACAAACGA499 PCR for pathogenity genes : TSST, enterotoxin (sem & seg) Gene determination was performed in General University Hospital of Patras

32. RESULTS The prevalence of MRSA among Staphylococcus aureus isolates in Romania by PCR (mec A gene+) There has been an increase in the prevalence of the MRSA isolated from hospitals over the years

33. The rate of the PVL-positive isolates among S. aureus strains Many researchers have highlighted the PVL gene as a reliable marker for CA-MRSA infections.

34. CA-MRSA IN Romania & in other European countries, PVL-positive

35. The CA-MRSA strains 3 clones of PVL-positive CA-MRSA, were isolated from patients. in Romania

36. The resistance phenotypes of CA-MRSA strains PVL+ clones Clone 1 is the multiresistant ST8-USA300 clone?; Clone 2 VISA is ST5 clone ? [4Clone 3 carrying the arg III gene: resistant to β-lactamins, K, FA, GISA - is the clone ST80, that was identified in Greece and it has also widespread to the rest of the European countries? [4].

37. Emerge of new MRSA clone ST8=USA300 a CA-MRSA clone, that carries characteristically the SCCmec type IVa, the Panton-Valentine leukocidin (PVL) & the enterotoxins Q, K, Yasuhiro Shibuya & all ”Emergence of the community-acquired methicillin-resistant Staphylococcus aureus USA300 clone in Japan” Journal of Infection and Chemotherapy, 2008, 14, 6, Tenover FC & all, Goering RV “Methicillin- resistant Staphylococcus aureus strain USA300: origin and epidemiology”, Antimicrob. Chemother. 2009, 64 (3): 441

38. is Resistance to oxacillin, erythromycin, ciprofloxacin, ± mefloxacine, ± tetracicline The typical antibiotic profile of ST8 - USA300

39. The prevalence of agr groups in S. aureus isolates agr+ = 46,8%

40. S.aureus arg positive strains

41. The agr group of MRSA clones

42. The role of agr during infection The association between agr specific groups and S. aureus infection type Jarraud et al. >> agr group IV strains ~ SSSS* Agr group III ~ TSS toxin1 producing isolates agr groups I and II ~ endocarditis agr group I ~ invasive infections, especially bacteremia *Staphylococcal scalded skin syndrome (SSSS)

43. The resistance phenotypes of the agr + MRSA strains Clone1 = ST8 - USA300 clone; Clone 2 VISA is ST5 clone ? Clone 3 = clone ST80 ? Clone 4 ~ Brazilian MRSA clone ?

44. The enterotoxin & agr genes in S. Aureus Our data suggests that 44,7% of S. aureus strains contain SEs (seg and sem in 29,8%), lower as reported by other authors for other European countries (e.g. in France, 85.4% expressed multiple SEs (19).

45. The enterotoxin genes in MRSA & MSSA isolates the enterotoxin genes (sem+ seg+) were detected in 21,3% MRSA & 23,4% MSSA isolates:

46. The enterotoxin genes in MRSA isolates the enterotoxins genes (sem & seg) were present both or alone in 21,3% MRSA from which in 8,5% CA-MRSA (PVL+ MRSA)

47. They are not significant differences in the enterotoxin genes content of these clones The enterotoxin genes in MSSA isolates

48. The Resistance phenotype of MSSA strains clone 1 = susceptible to all AB; clone 2 = GISA/GRSA; clone 3 = resistant to β lactam and E; clone 4 = resistant to Cip and E Clone 5 = resistant to β lactam and E; IS Clin; GISA

49. Conclusions Our results showed the circulation in our area of different MRSA clones with different resistance phenotypes, carrying the agr gene alone/associated with the enterotoxin genes and with the PVL genes. it doesn’t exist a correlation of the presence of the genes with a certain resistance phenotype, that could suggest their existence. → the necessity to trace S. aureus strains using the PCR method and involving them in clinical diseases

50. Local area Clinical microbiology Lab Higher forums  International programs: ICAR, SENTRY,  National surveillance programs Conclusions 57,5% MRSA, in Ro/ Cluj Napoca circulating phenotypes: First report in Romania PCR methods Surveillance of antibiotic resistance

51. …Thank you!