2. Chapter 12 DNA Also known as deoxyribonucleic acid

3. Intro to DNA

4. History of DNA In the mid 1900’s scientists started asking the question: –“How do genes work?” –Like many scientific stories, the discovery of DNA was an accident while a scientist was trying to find out something else

5. Frederick Griffith Griffith was working on what was causing the deadly disease pneumonia Griffith isolated two separate strains: –A disease causing strain –A harmless strain

6. Disease-causing bacteria (smooth colonies) Harmless bacteria (rough colonies) Heat-killed, disease- causing bacteria (smooth colonies) Control (no growth) Heat-killed, disease-causing bacteria (smooth colonies) Harmless bacteria (rough colonies) Dies of pneumoniaLives Live, disease-causing bacteria (smooth colonies) Dies of pneumonia Figure 12–2 Griffith’s Experiment

7. Griffith’s Experiment He found that mice injected with the disease-causing strain died of pneumonia However, if he heated the disease- causing strain and injected the mice with it they did not die at all This suggested that the disease wasn’t caused by a chemical toxin released by the bacteria

8. Griffith’s Experiment When he injected mice with the heat killed disease- causing bacteria they did not die –When he added the harmless bacteria to the heat killed bacteria they did develop pneumonia and die!

9. Griffith’s Experiment Somehow the heat killed bacteria passed on their ability to cause disease to the harmless strain!! Griffith called this process transformation – one strain of bacteria changing into another

10. Griffith’s Experiment Griffith hypothesized that some “factor” was transferred from the heat-killed bacteria to the live, harmless bacteria He hypothesized that this factor was a gene that the live bacteria obtained from the heat-killed bacteria

11. Oswald Avery’s Experiment In 1944 Avery repeated Griffith’s experiment –He changed it by creating an extraction of the “combined” bacteria and treating it with enzymes –These enzymes destroyed all of the proteins, fats, carbs, and RNA

12. Oswald Avery’s Experiment After he destroyed most of the organic components, transformation still occurred! He performed it one more time: –This time he destroyed the DNA in the mixture –As he had guessed, the mice lived –He concluded that it was the DNA that was responsible for the disease

13. Oswald Avery’s Experiment Avery’s Conclusion: –DNA is the nucleic acid that stores and transmits genetic information from one generation of organism to the next

14. Hershey-Chase Experiment Alfred Hershey and Martha Chase wanted to explain Avery’s findings further –They worked with bacteriophages “bacteria eater” They attach to the outside of a bacterium and inject their DNA into the cell The DNA instructs the cell to make copies of itself until the cell bursts with more bacteriophages

15. Hershey-Chase Experiment They put radioactive markers on the outside of the bacteriophage as well as on the DNA inside These markers can be seen or followed during an experiment to determine which is left “inside” the bacterium to “infect” it

16. Bacteriophage with phosphorus- 32 in DNA Phage infects bacterium Radioactivity inside bacterium Bacteriophage with sulfur-35 in protein coat Phage infects bacterium No radioactivity inside bacterium Hershey-Chase Experiment

17. Hershey and Chase concluded that the genetic material of the bacteriophage was DNA and not protein

18. Bacterial Transformation

19. 12.2 The Structure of DNA

21. DNA is a long molecule made up of nucleotides Each nucleotide is made up of three parts: –A 5-carbon sugar called deoxyribose –A phosphate group –And a nitrogenous base

22. The Nitrogenous Bases There are 4 kinds of Nitrogenous Bases: –The Pyrimidines: Cytosine Thymine –The Purines: Adenine Guanine *the sugar phosphate forms the “backbone” of the molecule

23. Purines AdenineGuanine Phosphate group Pyrimidines CytosineThymine Deoxyribose The Nucleotides

24. Chargaff’s Rules According to Erwin Chargaff: –Adenine always pairs with Thymine –Cytosine always pairs with Guanine

25. The Double Helix James Watson and Francis Crick –Using the X-ray taken by Rosalind Franklin (photo 51) –And compiling data and research over many years –Watson and Crick “unlocked” the secret structure of DNA in 1953 The building blocks of ALL life

26. The Double Helix base pairing- hydrogen bonds forming only between certain “base pairs”-What is called? Sugar- phosphate backbone Hydrogen bonds Nucleotide Key Adenine (A) Thymine (T) Cytosine(C) Guanine (G)

27. Chromosomes and DNA Replication DNA is the genetic material for the cell and the organism It is found in the nucleus of Eukaryotic cells

28. 12.3 Chromosomes and DNA Replication

29. Eukaryotic DNA Eukaryotic DNA has as many as 1000 times more base pairs as Prokaryotic DNA –It exists in the nucleus of the cell in the form of chromosomes –How many chromosomes make up a diploid human cell?

30. Eukaryotic DNA How does the nucleus of a cell contain more than 1 meter of DNA? Eukaryotic chromosomes contain DNA and protein in a substance called chromatin

31. Eukaryotic DNA Chromatin – DNA tightly coiled around proteins called histones Nucleosome – DNA and histones forming a beadlike structure DNA double helix Histones Coils Nucleosome Supercoils Chromosome

32. DNA Replication The way that DNA is constructed allows for exact duplication. When DNA is separated one side can be “copied” because of base pairing

33. Where does replication start? For a cell to divide, it must first replicate its DNA. This process is initiated at particular points in the DNA, known as originsorigins Which are targeted by proteins that separate the two strands and initiate DNA synthesis. Origins contain DNA sequences recognized by replication initiator proteins. These initiators recruit other proteins to separate the strands and initiate replication forks.

34. DNA Replication If you had a strand of DNA, but only one half of the strand, how would you create a complimentary strand? –Suppose you had the base pairs: ATGCCCGTAATGTAACCGTTGAA What would be the complimentary strand?

35. DNA Replication Replication – process by which DNA duplicates or “copies” itself. –during replication the strand of DNA separates into two strands –While this is happening two new strands are being formed simultaneously –This occurs at the replication fork

36. DNA Replication DNA is “unzipped” by a special enzyme called DNA polymerase –The polymerase adds new nucleotides to pair with the “old” strand –It also proofreads it before it finishes to make sure there are no mistakes

37. DNA Replication –The tips of chromosomes are known as telomeres. –The ends of DNA molecules, located at the telomeres, are particularly difficult to copy.

38. DNA Replication –Over time, DNA may actually be lost from telomeres each time a chromosome is replicated. –An enzyme called telomerase compensates for this problem. –By adding short, repeated DNA sequences to telomeres, lengthening the chromosomes slightly and making it less likely that important gene sequences will be lost from the telomeres during replication.

39. DNA Replication Replication fork DNA polymerase Replication fork New strand Nitrogenous bases Original strand

40. DNA Replication

41. The END of Chapter 12

42. Chapter 12 – 3 RNA and Protein Synthesis At this point we all know that DNA provides the genetic code for all life on the planet So, “how does it work?” The key is it’s relationship with RNA –Ribonucleic acid

43. Ch. 13 RNA and Protein Synthesis DNA is like a “library” of information in every cell of an organism RNA would be the “person” reading the individual ‘books’ in the library –The manufacture of proteins is ESSENTIAL for the life of the organism!

44. 13.1 Structure of RNA RNA is much like DNA in that it is a long chain of nucleotides There are THREE main differences: > the sugar in RNA is ribose > RNA is single stranded > RNA has Uracil in place of Thymine

45. fromtoto make up Three Types of RNA also calledwhich functions to also called which functions to can be RNA Messenger RNA Ribosomal RNA Transfer RNA mRNACarry instructions rRNA Combine with proteins tRNA Bring amino acids to ribosome DNARibosomeRibosomes

46. Transcription Transcription is the process of “making” RNA molecules by creating a complimentary strand to a section of DNA The enzyme responsible for “reading” the DNA code is RNA polymerase

47. Transcription During transcription, RNA polymerase attaches to the DNA and separates the strands The RNA polymerase then uses one strand of DNA as a template to make complimentary nucleotides into a strand of RNA

48. Transcription Adenine (DNA and RNA) Cystosine (DNA and RNA) Guanine(DNA and RNA) Thymine (DNA only) Uracil (RNA only) RNA DNA RNA polymerase

49. Transcription Promoters – specific sites where the RNA Polymerase binds to the strand of DNA to begin transcription

50. RNA Editing The “finished” mRNA strand has been edited before it goes to work The pieces that are kept are called exons The pieces that are “cut” are called introns

51. The Genetic Code Proteins are assembled in polypeptides –These are long chains of amino acids –There are 20 different types of amino acids –The properties of proteins are determined by which order these amino acids are joined

52. The Genetic Code mRNA is the key to the genetic code and it provides for the manufacture of all proteins in the body A strand of mRNA is read three base pairs at a time –UCGAAGCUUACA would be ….. –UCG-AAG-CUU-ACA

53. The Genetic Code Each of these amino acids that mRNA “codes” for recognizes the three base pair sequence A codon consists of three consecutive nucleotides that specify a single amino acid

54. The Genetic Code Along with the twenty amino acids there are “special” base pair sequences that “code for” start and stop codons Stop codons are like the “period at the end of a sentence”. –They signify the end of a polypeptide

55. The Genetic Code

56. Translation The decoding of a strand of mRNA into a protein is known as translation At this point we have taken a strand of DNA and created a strand of mRNA by the process of transcription –DNA  mRNA  polypeptide chain –Polypeptide chain  Protein The next step is to make proteins!!

57. Messenger RNA : Messenger RNA is transcribed in the nucleus. Transfer RNA mRNA Start codon Ribosome Methionine Phenylalanine tRNA Lysine Nucleus Figure 12–18 Translation mRNA

58. Translation As a strand of DNA is read during transcription a complimentary strand of RNA is made –TACAAGTTT (DNA) –AUGUUCAAA (RNA)

59. Translation That strand of RNA is known as mRNA and leaves the cell nucleus where it attaches to a ribosome AUGUUCAAA (mRNA)AUGUUCAAA (mRNA) Ribosome mRNA Start codon

60. Translation Each strand of mRNA is separated into three base pairs called codons AUG —- UUC --- AAA (mRNA)AUG —- UUC --- AAA (mRNA) This is where transfer RNA comes in (tRNA)This is where transfer RNA comes in (tRNA)

61. Translation tRNA is responsible for getting the right anticodon with each of the mRNA codons An amino acid is attached to each anticodon tRNA mRNA Ribosome Lysine

62. The Polypeptide “Assembly Line” The ribosome joins the two amino acids & breaks the bond between the tRNA & it’s amino acid mRNA Ribosome Translation direction Lysine tRNA Ribosome Growing polypeptide chain mRNA Completing the Polypeptide The process continues until the ribosome reaches one of the three stop codons. The result is a growing polypeptide chain. Figure 12–18 Translation

63. Translation The ribosome acts like an assembly line worker and attaches each amino acid to the next one. The ribosome also detaches the amino acid from it’s tRNA This happens until a stop codon is reached and there is a long chain of amino acids (a polypeptide)

64. Mutations Mutations are changes in the DNA sequence that affect genetic information Genetic mutations result from changes in a single gene Chromosomal mutations involve changes in whole chromosomes

65. Mutations Mutations that only affect one nucleotide are called point mutations –Point mutations generally only affect one amino acid in the sequence THE DOG BIT THE CAT THE DOG BIT THE CAR Normal: AUG-AAG-GGC-UAA Protein: Met - Lys - Gly - Stop Normal: AUG-AAG-AGC-UAA Protein: Met - Lys - Ser - Stop

66. Mutations Frameshift mutations are much more dangerous to the genetic code! They occur when a nucleotide is added (inserted) or deleted This “shifts” the reading frame of the gene THE DOG BIT THE CAT ** What happens if you remove the “G” in DOG THE DOB ITT HEC AT **The same would happen if you added a letter

67. Substitution Insertion Deletion Gene Mutations: Substitution, Insertion, and Deletion Mutations can be very dangerous and VERY SCARY!!

69. Mutations Chromosomal mutations involves the change in the number or structure of chromosomes There are Four Types: –Deletion – the loss of all or part of a chromosome –Duplication – when a segment of a chromosome is repeated –Inversion – When part of a chromosome becomes oriented in the reverse direction –Translocation – when part of a chromosome breaks off and attaches to another

71. Chromosomal Mutations Deletion Duplication Inversion Translocation

72. THE END