1. ChIP-seq Downstream Analysis Xiaole Shirley Liu STAT115, STAT215, BIO298, BIST520

2. Human TF Binding Distribution Most TF binding sites are outside promoters How to assign targets? Binding in promoter (how far)? Nearest distance? Number of binding? Other knowledge? Still open Q 2

3. Higher Order Chromatin Interactions Interactions ~ follows exponential decay with distance Lieberman-Aiden et al, Science 2009

4. How to Assign Targets for Enhancer Binding Transcription Factors? Regulatory potential: sum of binding sites weighted by distance to TSS with exponential decay Rank1 of genes based on binding 4 TSS

5. How to Assign Targets for Enhancer Binding Transcription Factors? Regulatory potential: sum of binding sites weighted by distance to TSS with exponential decay Rank1 of genes based on binding Rank2 of genes based on expression –Differential expression upon TF perturbation –Gene expression correlation in cohorts Rank ordered list of targets: Rank1 * Rank2 Only minority of binding sites is functional in a condition 5

6. BETA Binding expression target analysis Is TF an activator, repressor or both? –Do genes with higher regulatory potential show more up/down expression than random genes 6

7. BETA Binding expression target analysis Is TF an activator, repressor or both? –Do genes with higher regulatory potential show more up/down expression than random genes Functional analysis of targets? How can a factor be both activator and repressor? Collaborating transcription factors Motif analysis on the binding sites near up vs down genes separately 7 TF?? ER

8. Summary ChIP-seq identifies genome-wide in vivo protein-DNA interaction sites MACS for ChIP-seq peak calling –Shift reads, Poisson with dynamic λ ChIP-seq QC: FDR, fold, conservation, etc Functional analysis of ChIP-seq data: –Target identification –Activator / repressor function –Motif analysis 8 Break

9. Epigenetics Xiaole Shirley Liu STAT115, STAT215, BIO298, BIST520

10. Epigenetics Heritable changes in gene function that occur without a change in the DNA sequence –How come not all the motif sites are bound by the factor? –How come TF binding only regulate some of the nearby genes?

11. Epigenetics Functionally relevant changes to the genome that do not involve a change in the nucleotide sequence The study of heritable (transgenerational) changes in gene activity that are not caused by changes in the DNA sequence The study of stable, long-term alterations in the transcriptional potential of a cell that are not necessarily heritable

12. The Making of a Queen Larvae Queen Worker From Ting Wang, Wash U

13. Agouti Mice and DNA Methylation

14. In Human Nature vs nurture Zygotic twins: same DNA different epigenome North American Ice Storm of 1998

15. Conrad Hal Waddington (1905–1975) Developmental biologist Paleontologist Geneticist Embryologist Philosopher Founder for systems biology Epigenetic Landscape

16. Components DNA-methylation Nucleosome position and histone modifications Chromatin accessibility Higher order chromatin interactions Break

17. DNA Methylation 17

18. DNA Methylation Distribution in Mammalian Genomes In human somatic cells, 60%-80% of all CpGs (~1% of total DNA bases) are methylated –Most methylation is found in “repetitive” elements “CpG islands”, GC-rich regions that possess a high density of CpGs, remain methylation-free –The promoter regions of ~70% of genes have CpG islands

19. Two classes of DNA methyltransferases (DNMTs) Jones and Liang, 2009 Nature Review Genetics

20. Inheritance of DNA Methylation

21. DNA Methylation Detection Bisulfite sequencing –Unmethyl C  T, sequence 30X –High resolution, quantitative, but expensive! –RRBS enriches CpG rich regions for sequencing ACGGGCTTACTTGCTTTCCTACGGGCTTACTTGCTTTCCTACGGGCTTACTTGCTTTCCTACGGGC TTACTTGC CGGGTTTATTTGCTTTTTTATGGGC TGGGTTTATTTGCTTTTTTATGGGC TGGGTTTATTTGCTTTCCTATGGGC CGGGCTTATTTGCTTTCCTATGGGC 3/50/5 60% methylated 0% methylated

23. BS-seq Methylation Call Bismark: Krueger & Andrews, Bioinfo 2011 –Create additional sequence in the BWA index to account for the C -> T conversion Methylation or genome sequence difference? + ACGAACGCAACGACGAATGCAATG + ACGAATGCAATGACGAATGCAATG -TGCTTGTGTTGTTGCTTACGTTAC

24. Analysis Issues Methylation level within a short distance is consistent: smoothing across bigger regions Most regions are either mostly methylated or mostly unmethylated (dichotomy) Estimate tumor purity 24

25. DNA Methylation Controls Gene Expression Methylation at CpG islands often repress nearby gene expression Many highly expressed genes have CpG methylation on their exons Some genes could be imprinted, so maternal and paternal copies have different DNA methylation

26. Large Unmethylated Canyons 1,104 “Canyons” with > 3.5 Kb in the mouse HSC 26 Jeong et al. Nature Genetics. 2014

27. DNA Methylation in Cancer Prevalent misregulation of DNA methylation in cancer: global hypomethylation and CpG island hypermethylation Methylation variable regions in cancer

28. DNA Demethylation Recently, another type of DNA methylation called hydroxyl methylation (hmC) is found hmC is an intermediate step between mC and C. TET family of proteins are important for DNA demethylation Mutation in TET is linked to many cancers

29. Acknowledgement Evan Johnson, BU Ting Wang, Wash U Wei Li, Baylor 29