Presentation is loading. Please wait.

Presentation is loading. Please wait.

Mutations Announcement Quiz over Mutations on Monday! Test Wednesday!!! All genetics lessons.

Similar presentations


Presentation on theme: "Mutations Announcement Quiz over Mutations on Monday! Test Wednesday!!! All genetics lessons."— Presentation transcript:

1 Mutations Announcement Quiz over Mutations on Monday! Test Wednesday!!! All genetics lessons

2 I. Mutations Any change in DNA is a mutation. Most mistakes/changes happen during… DNA replication (during mitosis OR meiosis) Transcription Meiosis (nondisjunction) These occur naturally or can be caused by the environment, called mutagenic factors, like… Radiation (UV, X-Ray, Gamma Ray) Carcinogens (Tobacco use, pollution)

3 II. Mutations in Reproductive (Sex) Cells VS. Body cells -Mutations in sex cells (a.k.a. gametes) can be passed down to a person’s children, but might not affect the parent -Mutations in body cells cannot be passed on to your children, however, they can cause cancer or other problems

4 II. Mutations in sex cells -X-men and X-women would be a result of mutations in sex cells. These people inherited mutated (changed) DNA from their parents:

5 III. Cancer as a result of mutations in body cells:

6 Tongue cancer and lung cancer are often caused by changes in body cells as a result of smoking, so don’t smoke!!! Carcinogens- environmental/chemical factors that cause cancer

7 Radiation- Think Spider-Man!!!

8 Gene mutations There are two types of gene mutations: Point Frameshifts

9 IV. Point mutation - Also called a substitution - a change of one base in a DNA sequence. can cause an amino acid to change, which then changes the protein being made. Example: DNA  RNA  Amino Acid TAC  AUG  Met TTC  AAG  Lys -Only one letter was SUBSTITUTED (the A to a T) and the entire amino acid changed (from methionine to lysine).

10 IV. Point mutation Normal Point mutation mRNA Protein Stop mRNA Protein Replace G with A

11 Point mutations in our lives! Sickle cell anemia is a blood disease caused by a SUBSTITUTION point mutation. A single nucleotide is changed from “A” to “T” which causes the amino acid to change from glutamic acid to valine: Amino acids: Thr – Pro – Glu – Glu Normal: ACT CCT GAG GAG Sickle cell: ACT CCT GTG GAG Amino acids: Thr – Pro – Val – Glu

12 V. Frameshift mutation A frameshift mutation is when one nucleotide is inserted or deleted from the DNA or mRNA strand. Ex: DNA TACTTCAAACCGCGTAACATT mRNA Protein

13 Difference between a substitution mutation and a frameshift mutation. substitution

14 Questions: Is this a substitution mutation or a frameshift mutation? -It’s a substitution mutation because G was replaced with a T!

15 Questions: THE DOG BIT THE CAT THE DOG BIT THE CAR Substitution or frameshift? Substitution!

16 Questions THE DOG BIT THE CAT THE DOB ITT HEC AT Substitution or frameshift? Frameshift! The mutated sentence makes no sense (non-sense) and thus the protein will not be made

17 ATCGCGTATTCG ATCGGGTATTCG What mutation is this??

18 What mutation happened here?? ATCGCGTATTCG ATCGCTATTCG

19 What mutation happened here?? ATCGCGTATTCG ATCGCGTTATTCG

20 Chromosome Mutations There are two types of chromosome mutations Part of chromosome mutated Whole chromosome missing/ added

21 Partial chromosome mutations 4 major types Deletions Duplications Inversions Translocation

22 Partial Chromosome Mutations Deletion Part of the chromosome breaks off during mitosis or meiosis The illustration on the right depicts a deletion of the tip of the p arm of chromosome 5

23 deletion of the tip chromosome 5. causes a genetic condition called cri du chat syndrome(cry of the cat). Approximately 1 infant in 50,000 Common findings in children with cri du chat include a cat-like meowing cry, mental retardation, hypotonia in infancy, microcephaly, and characteristic facial features Age 6 And Age 16

24 Partial Chromosome Mutations Inversion Section of chromosome breaks off, changes direction and reattaches

25 Partial Chromosome Mutations Duplication A section of chromosome is repeated

26 Duplication of Chromosome mutation Charcot–Marie–Tooth disease disorder of the peripheral nervous system characterised by progressive loss of muscle tissue and touch sensation across various parts of the body.peripheral nervous system Currently incurable; affects approximately 1 in 2,500 people

27 Partial Chromosome Mutations Translocations Piece of broken chromosome recombines with a different chromosome

28 Translocation Chromosome mutation leukemia (acute myelogenous leukemia and chronic myelogenous leukemia)leukemiaacute myelogenous leukemiachronic myelogenous leukemia Infertility: One of the would- be parents carries a balanced translocation, where the parent is asymptomatic but conceived fetuses are not viable. Infertility

29 Whole chromosome Mutations Nondisjunction Chromosomes fail to split correctly during meiosis Can result in too many or too few chromosomes Examples: Down Syndrome, Turner syndrome

30 Turner Syndrome Loss of an X chromosome Complications include: short stature, swelling, broad chest, low hairline, low-set ears, and webbed necks, nonworking ovaries, congenital heart disease, hypothyroidism, diabetesshort statureswellinglow-set earswebbed necksovariescongenital heart diseasehypothyroidismdiabetes Down Syndrome Additional 21 chromosome Complications include: physical growth delays, characteristic facial features, and mild to moderate intellectual disability. Max IQ of 8-9 year old.physical growthfacial featuresintellectual disability


Download ppt "Mutations Announcement Quiz over Mutations on Monday! Test Wednesday!!! All genetics lessons."

Similar presentations


Ads by Google