1. Supplementary material Article title: Novel genes encoding hexadecanoic acid Δ6-desaturase activity in a Rhodococcus sp. Journal name: Current Microbiology Author name: Hiroyuki Araki*, Hiroshi Hagihara, Hirofumi Takigawa, Yukiharu Tujino, Katsuya Ozaki Affiliation: Tochigi Research Laboratories of Kao Corporation *E-mail address of the corresponding author: E-mail: araki.hiroyuki@kao.co.jp. Japan. Phone: +81-285-68-7591, Fax: +81-285-68-7403.

2. Fig. S1 The pattern of regiospecific desaturation of aliphatic substrates by Rhodococcus sp. strain cells. The figure illustrates typical examples of the desaturation reactions catalyzed by the rhodococcal cells.

3. Fig. S2 Construction of the primers on the basis of the histidine motifs conserved among known Δ6-desaturases. Primers 1, 2, 3, and 4 were 5’-YTGGTGGAAGGRYAABCAYAA-3’, 5’-RGGGAAVARRTGGTG-3’, 5’-CAYAAYNMDCAYCA-3’, and 5’-GTGGTGCTCRATCTGGWARTT-3’, respectively. Y, R, B, N, M, D, V, and W were represented in the primers as mixtures of C/T, A/G, C/T/G, A/C/G/T, A/C, A/G, A/C/G, and A/T, respectively. To amplify the region encoding this motif, primer 1 and 3 were designed as nested sense primers based on sequences around histidine box2, for which the consensus sequence is WWXXXHXXHH; similarly, primer 2 and 4 were designed as nested antisense primers based on sequences around histidine box3, for which the consensus sequence is XXQIEHHLFP; consensus sequences are based on fungus Mortierella, borage, worm, rat, and human desaturases. Each PCR mixture (25 μL) contained chromosomal DNA (50 ng), primers (0.5 μM), and TaKaRa Ex Taq polymerase. In order to increase target specificity, touch-down PCR was used to amplify a specific region; the conditions used were 94ºC for 1 min, 64ºC for 1 min, 72ºC for 1 min, 94ºC for 1 min, 62ºC for 1 min, 72ºC for 1 min, 94ºC for 1 min, 60ºC for 1 min, and 72ºC for 1 min for each of two cycles that followed incubation at 94ºC for 1 min. After these cycles, the conditions for 30 cycles of amplification were 94ºC for 1 min, 58ºC for 1 min, and 72ºC for 1 min for each cycle.

4. Fig. S3 Scheme for construction of the Rdes1 and Rdes2 expression plasmids. The Rdes1 ORF was introduced between the XbaI and XhoI sites in the pET-15b expression vector, and the Rdes2 ORF between NcoI and Bpu1102I sites in pET-15b. To introduce the Rdes1 ORF, the sense primer 5’- ATTATCTAGAATAAGGAGATATACCGTGGCCATCACCGATATCAAAGAGTT-3’, which included a XbaI and a ribosome binding site, and the antisense primer 5’-ATTACTCGAGTTATCACTTCCGGCGCTTCGGCAT-3’, which included a XhoI site, were used. To introduce the Rdes2 ORF, 5’-ATTACCATGGCGATTGCAGATGTCAAGGAA-3’, which included a NcoI site, and 5’-ATTTGCTCAGCGCAGGCCGAGGAGGCT-3’, which included a Bpu1102I site, were used as the sense and antisense primers, respectively. PCR with Pyrobest DNA polymerase was performed with 0.5 μM of each primer and 0.5-50 ng chromosomal DNA in 100-μL reaction volumes. PCR conditions for Rdes1 were 95ºC for 1 min, 66ºC for 1 min, and 72ºC for 1.5 min for each of 30 cycles; for Rdes2, they were 95ºC for 1 min, 64ºC for 1 min, and 72ºC for 1.5 for each of 30 cycles. After purification of PCR products, purified PCR products were digested with 10 to 50 units of the restriction enzymes mentioned above at 37ºC for 7 h to 18 h. The digested products were purified and ligated with 100 ng of pET-15b vector. The ligation products were purified and subject to ethanol precipitation; the ligated DNA was then dissolved in 5 μL of sterilized distilled water. A portion of each ligation solution (1 μL) was used to transform E. coli HB101.

5. Fig. S4 Schematic diagram of the genomic region isolated by inverse PCR. Gray bar indicates the region amplified in the first PCR series involving nesting and degenerate primers. Chromosomal DNA (2 μg) was digested with BamHI or SphI, at 37ºC over-night. The self-ligation products were purified, dried, and dissolved in 15 μl of sterilized distilled water. Inverse PCR was performed in two rounds of PCR. The first round was followed by a second round of nested PCR involving a primers set that combined a sense primer complementary to the C terminal end and anti sense primer complementary to the N terminal end; TaKaRa Ex Taq polymerase was used for amplification. The first round of PCR was performed with 5’-CCGACTGCCGAACAATGCGATACG-3’ and 5’- GCGAACTTCAATTCCGGCAAGCTC-3’, and the second round PCR with 5’-GCCGAGCTCCAACGCCCGCTGGAC-3’ and 5’- GGACTCATGAGCGGCAATCTGAAA-3’ (0.5 μM each). The PCR conditions in each cycle were 94ºC for 0.5 min, 55ºC for 0.5 min, and 72ºC for 4 min; each round of PCR comprised 30 cycles.

6. Fig. S5 Fatty acid analysis of transformed E. coli cells by GC and GC/MS. Panel a; GC chromatogram of transformants containing only pET-15b vector, Panel b; GC chromatogram of transformants expressed Rdes1, Panel c; GC chromatogram of transformants expressed Rdes2. Column temperature was held at 100ºC for 2 min, increased at a rate of 6ºC /min, and held at 210ºC for 25 min. Injection and detector temperatures were 250ºC and 270ºC, and the split ratio was 1:25.

7. Fig. S6 Mass spectrum of cis-6-hexadecenoic acid by GC/MS. Analysis conditions of GC/MS were described in the Materials and methods.