1. CELLULAR METABOLISM BIO 137 Anatomy & Physiology I

2. Metabolism The total of all chemical reactions in an organism that are necessary to maintain life Includes synthesis and breakdown of molecules These reactions are usually stepwise and are called metabolic pathways 2 Processes in Metabolism Catabolism Anabolism

3. Metabolic Pathways Catabolism Breakdown of larger molecules through Hydrolysis Exergonic (energy can be used to drive anabolic pathways) Example: oxidation (breakdown) of glucose in cellular respiration

4. Metabolic Pathways Anabolism Construction of larger molecules (polymers) from monomers through Dehydration Endergonic – requires energy Example: building a polypeptide chain and protein from amino acids

5. Metabolic Pathways Reactant(s) → Product(s) Stepwise Each step in a pathway is catalyzed by a specific enzyme Enzymes are protein catalysts A substrate is what an enzyme acts on Each enzyme is specific for a substrate Enzyme 1Enzyme 2Enzyme 3 A B C D Reaction 1Reaction 2Reaction 3 Starting molecule Product

6. Activation Energy, E A In a chemical reaction, bonds are broken in reactants, requiring an initial energy investment E A – amount of energy needed to break bonds in reactants E A is usually heat from surroundings

7. Enzymes Enzymes are protein catalysts that speed up the rate of a reaction without being consumed Enzymes are necessary because most reactions proceed very slowly and metabolism would be hindered A single enzyme can catalyze thousands of reactions a second

8. Enzyme-Substrate Binding Enzymes are PROTEINS with specific 3-dimensional conformations (shape) Shape of enzyme determines function (what substrate it will bind) Active site – region of an enzyme that binds a substrate Substrate ‘fits’ active site, forming enzyme-substrate complex Lock and key model In this form, enzyme converts substrate to product**

9. 1 Substrates enter active site; enzyme changes shape so its active site embraces the substrates (induced fit). Substrates Products Enzyme Enzyme-substrate complex 5 Products are Released. 2 Substrates held in active site by weak interactions, such as hydrogen bonds and ionic bonds. 3 Active site (and R groups of its amino acids) can lower E A and speed up a reaction by acting as a template for substrate orientation, stressing the substrates and stabilizing the transition state, providing a favorable microenvironment, participating directly in the catalytic reaction. 4 Substrates are Converted into Products. 6 Active site is available for two new substrate molecules. Catalytic Cycle of an Enzyme

10. Enzyme Activity is affected by Environment Enzymes have optimal conditions under which they work Optimal conditions favor correct conformation Any physical or chemical condition that affects an enzyme’s 3-dimensional shape can affect enzyme activity Temperature, pH, chemicals These conditions can change protein conformation = Denaturation Makes an enzyme inactive

11. WHY DO WE CARE SO MUCH ABOUT ENZYMES? Enzyme regulation is vital to the control of metabolism.

12. Metabolic Regulation Metabolism is controlled by regulation of enzyme activity 1. Alter gene expression of enzyme 2. Regulate enzymes already present in a cell (Allosteric Regulation)

13. Energy Energy is defined as the capacity to do work Includes kinetic energy and potential energy Energy can be transformed from one form to another Energy is used to fuel cellular work

14. Forms of Energy Kinetic Energy Energy of motion Light (photosynthesis), heat (random movement of atoms and molecules), Pool cue Potential Energy (PE) Stored energy due to location or structure Chemical Energy PE stored in molecules as a result of the arrangement of atoms in the molecule

15. Free Energy & Metabolism Chemical reactions can be classified based on how energy is used Exergonic Energy is given off in the reaction Spontaneous Endergonic Energy is required to start the reaction Not spontaneous

16. Energy and Metabolism Nutrients have potential energy (chemical energy) due to the arrangement of atoms Electrons in the bonds holding atoms together represent energy!! Energy can be given off when nutrients are broken down Chemical energy in glucose is converted to ATP energy during Cellular Respiration

17. Electrons and Energy Loss of electrons in nutrients as they are broken down allows for the production of ATP Very complicated, do not focus on details Know that electrons represent stored energy Electrons are shuttled in a cell by electron carriers and ultimately given to O 2, making H 2 O CO 2 is lost in several steps along the way Waste product of metabolism

18. ATP Adenosine Triphosphate Energy molecule of our cells Cells that require energy to perform functions use ATP for that energy Composed of 3 parts: Adenine molecule Ribose molecule 3 phosphate groups in a chain

19. Cellular Respiration Breakdown of nutrients in the presence of oxygen (aerobic) to yield ATP Involves shuttling of electrons from food to oxygen C 6 H 12 O 6 + 6 O 2 → 6CO 2 + 6H 2 O + (38 ATP) Breakdown is stepwise

20. Carbohydrate Metabolism Glucose is not just an example we happen to choose – it is indeed the body’s preferred source of fuel During digestion, polysaccharides and disaccharides are hydrolyzed into the monosaccharides glucose (80%), fructose, and galactose These three monosaccharides are absorbed into the villi of the small intestine and carried to the liver hepatocytes convert galactose and fructose to glucose

21. Cellular Respiration 3 major steps Glycolysis Initial breakdown of glucose Cytosol, anaerobic Citric Acid Cycle (Krebs) Matrix of mitochondria, aerobic Electron Transport Chain (Oxidative Phosphorylation) Cristae of mitochondria, aerobic This is where those electrons are used!

22. Glycolysis Glucose, C 6 H 12 O 6, is broken down into 2- pyruvate molecules (3C) Stepwise, where electrons are given off to electron carriers These are used in the Electron Transport Chain Occurs in the cytosol under Anaerobic conditions ATP is both consumed and made here

23. Glycolysis Net Phase 1 priming Phase 2 cleavage Phase 3 oxidation and formation of ATP and release of high energy electrons 2 ADP 2 NADH + H + 2 NAD + 2 NADH + H + 2 NAD + P ATP PP P Glyceraldehyde phosphate Glucose Dihydroxyacetone phosphate 2 4 ADP ATP 4 Fructose-1,6-diphosphate O2O2 2 Pyruvic acid 2 Lactic acid To citric acid cycle and electron transport chain (aerobic pathway) Carbon atom Phosphate P P Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. O2O2

24. Citric Acid Cycle (Krebs) Cycle where starting reactants are regenerated Cycle is completed 2X per glucose molecule Stepwise, where electrons are given off to electron carriers These are used in the Electron Transport Chain ATP is made CO 2 is formed as waste

26. RECALL THAT ELECTRONS REPRESENT STORED ENERGY Now we will use that stored energy to make ATP!

27. Electron Transport Chain **Energy found in electron carriers is now used to make ATP through oxidative phosphorylation Occurs on mitochondrial cristae Electrons are ultimately given to Oxygen and water is formed Energy given off during this process is used to make ATP!

28. Electron Transport Chain

30. ATP Energy transferred from cellular respiration used to reattach phosphate ADP ATP Energy transferred and utilized by metabolic reactions when phosphate bond is broken PPP PP PP Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

31. Fermentation Alcohol Fermentation Lactic Acid Fermentation In animals Pyruvate is converted to lactic acid Accumulates and causes muscle fatigue and soreness Yeasts and some bacteria Pyruvate is converted to ethanol If oxygen is not present after glycolysis, pyruvate is fermented

32. Fermentation 2 ADP + 2 P iP i 2 ATP Glycolysis Glucose 2 NAD + 2 NADH 2 Pyruvate 2 Acetaldehyde 2 Ethanol (a) Alcohol fermentation 2 ADP + 2 P i 2 ATP Glycolysis Glucose 2 NAD + 2 NADH 2 Lactate (b) Lactic acid fermentation H H OH CH 3 C O – O C CO CH 3 H CO O–O– CO CO O C O C OHH CH 3 CO 2 2 2 Pyruvate +2 H +

33. Carbohydrate Storage Excess glucose is stored as glycogen (liver and muscle cells) Can be converted to fat and amino acids 4-22 BREAKDOWN BUILD UP

34. Catabolism of proteins, fats and carbohydrates High energy electrons carried by NADH and FADH 2 Complete oxidation of acetyl coenzyme A to H 2 O and CO 2 produces high energy electrons (carried by NADH and FADH 2 ), which yield much ATP via the electron transport chain Breakdown of simple molecules to acetyl coenzyme A accompanied by production of limited ATP and high energy electrons H2OH2O 2e – and 2H + Waste products –NH 2 CO 2 Citric acid cycle Electron transport chain Amino acids Acetyl coenzyme A Simple sugars (glucose) GlycerolFatty acids Proteins (egg white) Carbohydrates (toast, hashbrowns) Food Fats (butter) Pyruvic acid ATP Breakdown of large macromolecules to simple molecules Glycolysis 1 2 3 ATP Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. © Royalty Free/CORBIS. ½ O 2 Fig. 4.15 High energy electrons carried by NADH and FADH 2 Complete oxidation of acetyl coenzyme A to H 2 O and CO 2 produces high energy electrons (carried by NADH and FADH 2 ), which yield much ATP via the electron transport chain Breakdown of simple molecules to acetyl coenzyme A accompanied by production of limited ATP and high energy electrons H2OH2O 2e – and 2H + Waste products –NH 2 CO 2 Citric acid cycle Electron transport chain Amino acids Acetyl coenzyme A Simple sugars (glucose) GlycerolFatty acids Proteins (egg white) Carbohydrates (toast, hashbrowns) Food Fats (butter) Pyruvic acid ATP Breakdown of large macromolecules to simple molecules Glycolysis 1 2 3 ATP © Royalty Free/CORBIS. ½ O 2

35. Central Dogma DNA RNA Protein DNA sequence contains information to direct protein synthesis (MAKE A PROTEIN) Replication Transcription Translation

36. Genetics Genetic information inherited from our parents is found in our DNA Gene Sequence of DNA nucleotides that codes for a protein DNA sequence contains information to direct protein synthesis Gene product = A protein

37. Genetics A Protein performs the function of the gene All of the DNA in a cell constitutes its genome

38. DNA Structure DNA is composed of nucleotides DNA Nucleotide: Deoxyribose sugar Phosphate group Nitogen containing base PURINE Adenine, A Guanine, G PYRIMIDINE Cytosine, C Thymine, T

39. DNA Structure DNA is double stranded Each strand is composed of repeating nucleotides Joined together by hydrogen bonds between complimentary bases A binds T (2 H-bonds) G binds C (3 H-bonds) Sugar-phosphate backbone

40. Fig. 4.19a GC G G A T C C A P GC P T P P C G P G P C P A P P P Thymine (T) Cytosine (C) Adenine (A) Guanine (G) Hydrogen bonds Nucleotide strand Segment of DNA molecule (a) GC G G A T C C A P G C P T P P C G P G P C P A P P P Thymine (T) Cytosine (C) Adenine (A) Guanine (G) Hydrogen bonds Nucleotide strand Segment of DNA molecule (a) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

41. DNA Replication Occurs in the nucleus DNA unwinds and is replicated before a cell divides Makes an identical copy of DNA using parental DNA as a template

42. DNA Replication DNA Replication is semi-conservative Resulting DNA is half-old, half-new Parental DNA (template) and newly synthesized DNA DNA Polymerase enzyme responsible for addition of nucleotides A binds T (2 H-bonds) G binds C (3 H-bonds)

43. DNA Replication

44. Replication Example TACAGTCCATTCACCTAGGATATT

45. Ribonucleic Acid RNA is also composed of nucleotides Ribose sugar Phosphate group Bases A, Uracil (U) C, G

46. RNA STRUCTURE RNA is single stranded An RNA copy of DNA is made during Transcription

47. Comparison of DNA & RNA DNARNA Sugar Bases # of Strands

48. Types of RNA Messenger RNA, mRNA  Carries code (message) for protein to be synthesized Transfer RNA, tRNA  Carries appropriate amino acid to ribosome to be incorporated into protein  The RNA component of the ribosome (recall that a ribosome is composed of RNA plus protein) Ribosomal RNA, rRNA

49. Transcription Occurs in the nucleus Make a messenger RNA copy of the DNA (gene) RNA Polymerase enzyme copies the DNA Base Pairing DNARNA AU TA CG GC

50. Transcription **Only transcribe a gene when it is needed All cells have the same genes but have differential expression of those genes

51. Transcription Transcribe the following DNA sequence: TACAGTCCATTCACCTAGGATATT

52. Following transcription, the mRNA leaves the nucleus and enters the cytosol where it is threaded through a ribosome to undergo translation.

53. Translation mRNA is translated into protein Occurs on the ribosome mRNA is read 3 bases at a time These are called codons Each codon corresponds to an amino acid

54. The Genetic Code There are 64 codons that make up the genetic code Each codon corresponds to an amino acid 20 amino acids in nature Code is redundant 1 START codon: AUG 3 STOP codons: UAA, UAG, UGA Amino acids are attached to a specific tRNA tRNA carries the amino acid to the growing polypeptide chain

55. Genetic Code

56. Translation 1 st codon of every gene is always AUG START codon Translation begins at AUG Translation ends when a STOP codon is reached UAA, UAG, UGA Remember, Amino acids are attached to a specific tRNA Has anticodon sequence If mRNA is UAA, tRNA anticodon is AUU

57. Translate the mRNA sequence from before

58. Translation Each time a codon is read, a new amino acid is added to a growing chain Peptide bonds form between each amino acid When a STOP codon is reached, the protein is released

59. Fig. 4.24 Messenger RNA Transfer RNA Next amino acid Anticodon Codons Growing polypeptide chain 1 1 2 2 3 3 4 4 5 5 6 6 7 C U G G Messenger RNA Transfer RNA Next amino acid Ribosome 1 1 2 2 3 3 7 4 4 5 5 67 C C CGU CUGCGU Messenger RNA Transfer RNA Next amino acid Anticodon Codons Growing polypeptide chain 1 1 2 2 3 3 4 4 5 5 6 6 7 Peptide bond CUGCGU CCGCGU 6 Messenger RNA Transfer RNA Next amino acid 1 1 2 2 3 3 4 4 5 5 67 6 7 UCGGAAAAAAGGGGGGGGCCCCCCCUU UCGGAAAAAAGGGGGGGGCCCCCCCUU UCGGAAAAAAGGGGGGGGCCCCCCCUU UCGGAAAAAAGGGGGGGGCCCCCCCUU The transfer RNA molecule for the last amino acid added holds the growing polypeptide chain and is attached to its complementary codon on mRNA. A second tRNA binds complementarily to the next codon, and in doing so brings the next amino acid into position on the ribosome. A peptide bond forms, linking the new amino acid to the growing polypeptide chain. The tRNA molecule that brought the last amino acid to the ribosome is released to the cytoplasm, and will be used again. The ribosome moves to a new position at the next codon on mRNA. A new tRNA complementary to the next codon on mRNA brings the next amino acid to be added to the growing polypeptide chain. 2 1 3 4 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

60. Messenger RNA 1 DNA information is copied, or transcribed, into mRNA following complementary base pairing 2 3 4 As the ribosome moves along the mRNA, more amino acids are added 5 At the end of the mRNA, the ribosome releases the new protein 6 tRNA molecules can pick up another molecule of the same amino acid and be reused Amino acids attached to tRNA Cytoplasm DNA double helix DNA strands pulled apart Transcription (in nucleus) Translation (in cytoplasm) Nucleus C Codon 1 Codon 2 Codon 3 Codon 4 Codon 5 Codon 6 Codon 7 G G G G G A A A U U C C C C C C G G G A Methionine Glycine Amino acids represented Serine Alanine Threonine Alanine Glycine DNA strand Messenger RNA A T A A T T T AT AT AT AT AT UA UA UA G C C GC GC G C GC GC G C G G C C GC CG U A CG C G G G G G G G G G G C C C C C C C C C C A A A A A T TA AT AT AT AT CG GC GC GC TA TA TA CG AT GC TA CG TA CG CG GC AT TA CG GC T T G CG CG CG CG CG CG CG C G Nuclear pore Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. mRNA leaves the nucleus and attaches to a ribosome Translation begins as tRNA anticodons recognize complementary mRNA codons, thus bringing the correct amino acids into position on the growing polypeptide chain Polypeptide chain G C CG A G G C U C T C C G A G Direction of reading

61. Mutations Result from an error in DNA sequence Caused by many things: Chemicals, error in replication, sunlight, X-rays Mutations affect the protein product of a gene Not made Made, but wrong conformation Non-functional Protein Made in excess

62. Mutations Affect Protein Product Sickle-cell anemia Results from a single amino acid change in the gene that codes for hemoglobin This defect causes RBCs to become sickle-shaped in low oxygen situations

63. Mutations Affect Protein Product Non-functional protein Hemoglobin in Sickle Cell Trait/Anemia CFTR pump in Cystic Fibrosis In the DNA, the mutant template strand has an A where the wild-type template has a T. The mutant mRNA has a U instead of an A in one codon. The mutant (sickle-cell) hemoglobin has a valine (Val) instead of a glutamic acid (Glu). Mutant hemoglobin DNAWild-type hemoglobin DNA mRNA Normal hemoglobinSickle-cell hemoglobin Glu Val C TT C AT G AA G UA 35 35 5353

64. Light Micrograph – Sickle Cell Anemia RBC’s