1. Web Databases for Drosophila
An introduction to web tools, databases and NCBI BLAST
Wilson Leung 08/2017

2. Agenda GEP annotation project overview
Web databases for Drosophila annotation
UCSC Genome Browser
NCBI / BLAST
FlyBase
Gene Record Finder

3. Start codon Coding region Stop codon Intron donor Intron acceptor UTR
AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCTTAAAAAAGAGCAAGAACAGTTTAACCATTGAAAACAAGATTATTCCAATAGCCGTAAGAGTTCATTTAATGACAATGACGATGGCGGCAAAGTCGATGAAGGACTAGTCGGAACTGGAAATAGGAATGCGCCAAAAGCTAGTGCAGCTAAACATCAATTGAAACAAGTTTGTACATCGATGCGCGGAGGCGCTTTTCTCTCAGGATGGCTGGGGATGCCAGCACGTTAATCAGGATACCAATTGAGGAGGTGCCCCAGCTCACCTAGAGCCGGCCAATAAGGACCCATCGGGGGGGCCGCTTATGTGGAAGCCAAACATTAAACCATAGGCAACCGATTTGTGGGAATCGAATTTAAGAAACGGCGGTCAGCCACCCGCTCAACAAGTGCCAAAGCCATCTTGGGGGCATACGCCTTCATCAAATTTGGGCGGAACTTGGGGCGAGGACGATGATGGCGCCGATAGCACCAGCGTTTGGACGGGTCAGTCATTCCACATATGCACAACGTCTGGTGTTGCAGTCGGTGCCATAGCGCCTGGCCGTTGGCGCCGCTGCTGGTCCCTAATGGGGACAGGCTGTTGCTGTTGGTGTTGGAGTCGGAGTTGCCTTAAACTCGACTGGAAATAACAATGCGCCGGCAACAGGAGCCCTGCCTGCCGTGGCTCGTCCGAAATGTGGGGACATCATCCTCAGATTGCTCACAATCATCGGCCGGAATGNTAANGAATTAATCAAATTTTGGCGGACATAATGNGCAGATTCAGA
ACGTATTAACAAAATGGTCGGCCCCGTTGTTAGTGCAACAGGGTCAAATATCGCAAGCTCAAATATTGGCCCAAGCGGTGTTGGTTCCGTATCCGGTAATGTCGGGGCACAATGGGGAGCCACACAGGCCGCGTTGGGGCCCCAAGGTATTTCCAAGCAAATCACTGGATGGGAGGAACCACAATCAGATTCAGAATATTAACAAAATGGTCGGCCCCGTTGTTATGGATAAAAAATTTGTGTCTTCGTACGGAGATTATGTTGTTAATCAATTTTATTAAGATATTTAAATAAATATGTGTACCTTTCACGAGAAATTTGCTTACCTTTTCGACACACACACTTATACAGACAGGTAATAATTACCTTTTGAGCAATTCGATTTTCATAAAATATACCTAAATCGCATCGTC
Start codon
Coding region
Stop codon
Intron donor
Intron acceptor
UTR

4. Annotation – adding labels to a sequence
6/25/12
Annotation – adding labels to a sequence
Genes: Novel or known genes, pseudogenes
Regulatory Elements: Promoters, enhancers, silencers
Non-coding RNA: tRNAs, miRNAs, siRNAs, snoRNAs
Repeats: Transposable elements, simple repeats
Structural: Origins of replication
Experimental Results:
DNase I Hypersensitive sites
ChIP-chip and ChIP-Seq datasets (e.g. modENCODE)
Use D. melanogaster as our reference

5. GEP Drosophila annotation projects
6/25/12
GEP Drosophila annotation projects
D. melanogaster
D. simulans
D. sechellia
Reference
D. yakuba
D. erecta
Published
D. ficusphila
D. eugracilis
D. biarmipes
TSS projects for
Fall 2017 / Spring 2018
D. takahashii
D. elegans
D. rhopaloa
Annotation projects for
Fall 2017 / Spring 2018
D. kikkawai
D. bipectinata
D. ananassae
D. pseudoobscura
New species sequenced by modENCODE
D. persimilis
D. willistoni
D. mojavensis
D. virilis
D. grimshawi
Phylogenetic tree produced by Thom Kaufman as part of the modENCODE project

6. Gene annotation workflow
6/25/12
Visualize a genomic region with evidence tracks
GEP UCSC Genome Browser
Identify interesting features and putative orthologs
NCBI BLAST
Learn about the putative D. melanogaster ortholog
NCBI / FlyBase
feature = some interesting region in the genome
Understand the gene and isoform structure
Gene Record Finder

7. UCSC Genome Browser Provide graphical view of genomic regions
Sequence conservation
Gene and splice site predictions
RNA-Seq and splice junction predictions
BLAT – BLAST-Like Alignment Tool
Map protein or nucleotide sequences against an assembly
Faster but less sensitive than BLAST
Table Browser
Access data used to create the graphical browser

8. UCSC Genome Browser overview
6/25/12
Genomic sequence
BLASTX alignments
Gene predictions
Evidence tracks
RNA-seq
Repeats
Comparative genomics

9. Control how evidence tracks are displayed on the Genome Browser
Most evidence tracks have five display modes:
Hide: track is hidden
Dense: all features (including overlapping features) are displayed on a single line
Squish: overlapping features are drawn on separate lines, features are half the height compared to full mode
Pack: overlapping features are drawn on separate lines, features are the same height as full mode
Full: Each feature is displayed on its own line
Some annotation tracks (e.g., RepeatMasker) only have a subset of these display modes

10. Two different versions of the UCSC Genome Browser
Official UCSC Version
Published data, lots of species, whole genomes; used for “Chimp Chunks”
GEP Version
GEP projects, parts of genomes; used for annotation of Drosophila species

11. Additional training resources
Training section on the UCSC web site
Videos
User guides
Mailing lists
OpenHelix tutorials and training materials
Pre-recorded tutorials
Quick reference cards

12. UCSC Genome Browser demo

13. Use BLAST to detect sequence similarity
BLAST = Basic Local Alignment Search Tool
Why is BLAST popular?
Provide statistical significance for each match
Good balance of sensitivity and speed
Find local regions of similarity irrespective of where they are in the sequence

14. Common types of BLAST programs
Except for BLASTN, all alignments are based on comparisons of protein sequences
Decide which BLAST program to use based on the type of query and subject sequences:
Program
Query
Database (Subject)
BLASTN
Nucleotide
BLASTP
Protein
BLASTX
Nucleotide → Protein
TBLASTN
TBLASTX
BLASTN compares nucleotide sequences directly. Other BLAST programs compare protein sequences

15. Common BLAST programs use cases
BLASTN: Search for similar nucleotide sequences
Map contigs to genome, mRNAs/ESTs to genome
BLASTP: Search for proteins similar to predicted genes
BLASTX: Map protein / exons against genomic sequence
TBLASTN: Map protein against genomic assemblies
TBLASTX: Identify genes in unannotated sequences
See the “BLAST Homepage and Selected Search Pages” document for details:
ftp://ftp.ncbi.nlm.nih.gov/pub/factsheets/HowTo_BLASTGuide.pdf

16. NCBI BLAST nucleotide databases
GenBank Non-Redundant Nucleotide Database (nr/nt)
Most comprehensive but some entries are low quality
Exclude sequences from whole genome assemblies, ESTs
RefSeq RNA Database
mRNA and non-coding RNA entries from the NCBI Reference Sequence Project
Include real and computationally predicted sequences
Expressed Sequence Tag (EST) Database
ESTs are short single reads of cDNA clones
High error rate but useful for identifying transcribed loci

17. NCBI BLAST protein databases
GenBank Non-Redundant Protein Database (nr)
Most comprehensive but some entries are low quality
Include sequences from both RefSeq and UniProtKB
RefSeq Protein Database
Sequences from the NCBI Reference Sequence Project
Higher quality than the nr database
Include real and computationally predicted sequences
UniProtKB / Swiss-Prot Protein Database
Manually curated proteins from literature
Real proteins with known functions
Much smaller database than either RefSeq or nr

18. Where can I run BLAST? NCBI BLAST web service EBI BLAST web service
EBI BLAST web service
FlyBase BLAST (Drosophila and other insects)

19. Include welcome to the Mac
NCBI BLAST demo

20. National Center for Biotechnology Information (NCBI)

21. Key features of NCBI Strengths Weaknesses Use cases
Most comprehensive among publicly available databases
PubMed for literature searches
Comprehensive BLAST web service
Weaknesses
Web site is large and complex
Quality of GenBank records may vary
Use cases
Perform BLAST searches against Refseq, nr/nt databases
Use BLAST (bl2seq) to align two or more sequences

22. FlyBase - Database for the Drosophila research community

23. Key Features of FlyBase
Lots of ancillary data for each gene in Drosophila
Curation of literature for each gene
Reference Drosophila annotations for all the other databases (including NCBI)
Fast release cycle (6-8 releases per year)
Use cases
Species-specific BLAST searches
Genome browsers (GBrowse/JBrowse), RNA-Seq search, and access datasets for 20 Drosophila species
20 species – where WGS data is available

24. Web databases and tools
Many genome databases available
Be aware of different annotation releases
Use FlyBase as the canonical reference
Web databases are being updated constantly
Update GEP materials before semester starts
Discrepancies in exercise screenshots
Minor changes in search results
Let us know about errors or revisions
Feel free to use the database you feel most comfortable with
FlyBase release updates 6 times each year

25. Include welcome to the Mac
FlyBase demo

26. Gene Record Finder

27. Key features of the Gene Record Finder
List of unique coding and non-coding exons for each gene in D. melanogaster
CDS and exon usage maps for each isoform
Optimized for exon-by-exon annotation strategy
Slower update release cycle than FlyBase
Database is updated every semester
Use cases:
Get amino acid sequences and nucleotide sequences of each exon for BLAST 2 Sequences (bl2seq) searches
Seen in the Introduction to NCBI BLAST exercise

28. Gene Record Finder demo

29. Summary
GEP annotation project seeks to generate high quality manually curated gene models for multiple Drosophila species
Use BLAST to characterize a genomic sequence
Use web databases to gather information on a gene
UCSC Genome Browser
NCBI
FlyBase
Gene Record Finder

30. Questions?

32. Ensembl Metazoa: Databases for 12 Drosophila species

33. Key features of Ensembl Metazoa
Lots of ancillary data for each gene
Data for 12 Drosophila species available
Detailed information on each gene available at the transcript, peptide, and exon level
Not always up-to-date
Annotations are from FlyBase Release 6.02
Use cases
Get amino acid sequences and nucleotide sequences of each exon for bl2seq searches
Perform species-specific BLAST searches
FlyBase is up to release 6.13
Has data on the Drosophila population genome project (SNPs in 50 Drosophila genomes)