Presentation is loading. Please wait.

Presentation is loading. Please wait.

Protein Expression Systems

Similar presentations


Presentation on theme: "Protein Expression Systems"— Presentation transcript:

1 Protein Expression Systems
Bacterial Cell-free Yeast Mammalian Insect

2 Protein Expression in Bacteria
Advantages/disadvantages Genetic elements essential for the expression Overview of the available expression systems and expression strains

3 Advantages Fast growth Cheap medium and equipment for growing
Good knowledge of the host

4 Disadvantages Limitation for expression of eukaryotic proteins due to:
differences in post-translational modifications SS bonds, glycosylation etc etc different frequencies with which the different codons appear in genes of these organisms E.g. CGT, CGC, CGG, AGG, AGA, CGA code for arginine, but the last 3 (AGG, AGA, CGA) are rarely used in E. coli and it has low amounts of respective tRNAs.

5 Disadvantages Accumulation of lipopolysaccharides (generally referred to as endotoxins) …

6 Goals To obtain as much as possible /good expression+good cell growth
soluble folded protein /reduced aggregation in a form that is easy to purify /use of secretion and tags Common problem: High expression  danger of aggregation  decreased cell growth

7 pTrc99 Translational vector

8 Genetic Elements Essential for Expression

9 Replication Origin Plasmid Replicon Copy Number pBR322 pMB1 15-20 pUC
pACYC p15A 18-22 pSC101 5 colE1

10 pTrc99 Translational vector

11 Genetic Elements Essential for Expression

12

13

14 Genetic Elements Essential for Expression

15 RBS, START, and STOP GAAGGAATTCAGGAGCCCTTCACCATG ... ...
Ribosome Bindind Site (RBS): RBS RBS n START GAAGGAATTCAGGAGCCCTTCACCATG START codons: E. coli uses 77% ATG (AUG), 14% GTG (GUG), 8% TTG (UUG) and a few others STOP codons: TAG (UAG), TAA (UAA), TGA (UGA),

16 Genetic Elements Essential for Expression

17 Promoters Host’s promoters Promoters from phages
2500 in the entire genome of E. coli K12 strain Most frequently used: Plac / Ptac / Ptrc, PPBAD, rhaPBAD Regulation of expression Promoters from phages T7, T3, SP6, T5, PL - Highly efficient and specific expression

18 Plac: Regulation

19

20 Plac, Ptac, Ptrc: Characteristics
Level of expression (inductor) Key features Plac Low level up to middle (IPTG) Weak, regulated. Suitable for expression of gene products at very low intracellular level. Comparatively expensive induction. Ptac Ptrc (trp-lac) Moderately high (IPTG) High-level, but lower than T7 system. Regulated expression still possible. Comparatively expensive induction. High basal level.

21 pBAD

22 PPBAD: Regulation PBAD.
- expression of the gene is controlled by the AraC activator. Expression from PARA is induced to high levels on media containing arabinose. Moreover, expression from PARA is tightly shut off on media containing glucose but lacking arabinose. ranscription by PBAD High Arabinose Low Arabinose High Glucose Repressed Low Glucose Active

23 Level of expression (inductor)
PPBAD and RhaPBAD Level of expression (inductor) Key features PPBAD Variable from low to high level (L-arabinose) Can fine-tune expression levels in a dose-dependent manner. Tight regulation possible. Low basal level. Inexpensive inducer. rhaPBAD (L-rhamnose) Tight regulation. Low basal activity. Relatively expensive inducer.

24 pET

25 Level of expression (inductor)
Phage Promoters Level of expression (inductor) Key features T7 T5 Very high High Utilizes T7 RNA polymerase. Utilizes E. coli RNA polymerase.

26 Combinations

27 Co-expression from two plasmids

28 pQE Translational vector + CDR

29 pET

30 pCR&pEXP

31 pTrc99 Translational vector

32 Expression strains

33 Expression optimization
To optimase: Level of inducer (e.g. arabinose) Time of induction Temperature of the induction step (popular - 18oC overnight)


Download ppt "Protein Expression Systems"

Similar presentations


Ads by Google