ACGCACTTCAGAACGCGTACTGACTGAA

ACGCACTTCAGAACGCGTACTGACTGAA
TGCGTGAAGTCTTGCGCATGACTGACTT 2 3 4

What is DNA Day?

What is DNA Day? April 1953 Drs. James Watson and Francis Crick determined the structure of DNA (double helix) with contributions by Drs. Rosalind Franklin and Marvin Wilkins What is DNA Day? 50 years later, in April 2003, the Human Genome Project determined the entire sequence of human DNA. Research scientists are using the knowledge and technology generated by this project to further understand how your DNA sequence can contribute to disease.

What is DNA Day? April 1953 April 2003
Drs. James Watson and Francis Crick determined the structure of DNA (double helix) with contributions by Drs. Rosalind Franklin and Marvin Wilkins What is DNA Day? 50 years later, in April 2003, the Human Genome Project determined the entire sequence of human DNA. Research scientists are using the knowledge and technology generated by this project to further understand how your DNA sequence can contribute to disease. April 2003 Human Genome Project determined the entire DNA sequence of a human (3 billion letters)

Urgent Announcement from the Principal!
Select 3-4 student volunteers to perform skit. Role of the principal may be played by the ambassador or a student. Read “Missing Mascot” Skit

DNA DNA stands for Deoxyribonucleic acid
DNA is the chemical compound that contains the genetic information for the function of living organisms DNA is made of two twisting, paired strands of chemical units called nucleotide bases, which form the double helix that Watson and Crick described over 50 years ago. Make sure to note that DNA is negatively charged - important for gel electrophoresis analysis later.

DNA What does DNA stand for? DNA stands for Deoxyribonucleic acid
DNA is the chemical compound that contains the genetic information for the function of living organisms DNA is made of two twisting, paired strands of chemical units called nucleotide bases, which form the double helix that Watson and Crick described over 50 years ago. Make sure to note that DNA is negatively charged - important for gel electrophoresis analysis later.

DNA What does DNA stand for? What is DNA?
DNA stands for Deoxyribonucleic acid DNA is the chemical compound that contains the genetic information for the function of living organisms DNA is made of two twisting, paired strands of chemical units called nucleotide bases, which form the double helix that Watson and Crick described over 50 years ago. Make sure to note that DNA is negatively charged - important for gel electrophoresis analysis later.

What is the structure of DNA? DNA stands for Deoxyribonucleic acid DNA is the chemical compound that contains the genetic information for the function of living organisms DNA is made of two twisting, paired strands of chemical units called nucleotide bases, which form the double helix that Watson and Crick described over 50 years ago. Make sure to note that DNA is negatively charged - important for gel electrophoresis analysis later.

What is the structure of DNA? Is DNA negatively or positively charged? DNA stands for Deoxyribonucleic acid DNA is the chemical compound that contains the genetic information for the function of living organisms DNA is made of two twisting, paired strands of chemical units called nucleotide bases, which form the double helix that Watson and Crick described over 50 years ago. Make sure to note that DNA is negatively charged - important for gel electrophoresis analysis later.

The DNA Alphabet Nucleotide bases are: adenine, thymine, cytosine, and guanine ATCG The sequence of these four letters make up our genes. The Human Genome Project determined the order of each of these letters in all of our genes.

The DNA Alphabet How many nucleotide bases in DNA are there?
Nucleotide bases are: adenine, thymine, cytosine, and guanine ATCG The sequence of these four letters make up our genes. The Human Genome Project determined the order of each of these letters in all of our genes.

The DNA Alphabet How many nucleotide bases in DNA are there? FOUR
Nucleotide bases are: adenine, thymine, cytosine, and guanine ATCG The sequence of these four letters make up our genes. The Human Genome Project determined the order of each of these letters in all of our genes.

What are the names of these bases? Nucleotide bases are: adenine, thymine, cytosine, and guanine ATCG The sequence of these four letters make up our genes. The Human Genome Project determined the order of each of these letters in all of our genes.

What are the names of these bases? Guanine, Adenine, Cytosine and Thymine (G, A, C and T) Nucleotide bases are: adenine, thymine, cytosine, and guanine ATCG The sequence of these four letters make up our genes. The Human Genome Project determined the order of each of these letters in all of our genes.

What are the names of these bases? Guanine, Adenine, Cytosine and Thymine (G, A, C and T) Nucleotide bases are: adenine, thymine, cytosine, and guanine ATCG The sequence of these four letters make up our genes. The Human Genome Project determined the order of each of these letters in all of our genes. The sequence of these letters make up our genes. The Human Genome Project determined the order of each of these letters in all of our genes.

Genes contain instructions to make proteins
Information is stored in DNA Genotype RNA Synthesis (transcription) RNA copy Protein Synthesis (translation) Gene = segment of DNA that tells the cell how to make a certain protein. Proteins work together to form the functional machinery that makes up a cell. The central dogma of molecular biology was established by Francis Crick in 1958. The Central Dogma states that DNA provides the instructions for making RNA, and RNA then provides the instructions for making protein. The overall concept of protein synthesis is basic, but the details of this process are quite complex and we wont go into those today. Basically DNA information is copied into messenger RNA (mRNA) by the process known as transcription and proteins are synthesized using the information in the mRNA as a template in a process known as translation. Can anyone tell me one of the differences between DNA and RNA? Bases: Thymine (DNA) and Uracil (RNA) Here are all the ways they differ: ･They differ in composition: 1.The sugar in RNA is ribose, not the deoxyribose in DNA. 2.The base uracil is in RNA instead of thymine. ･They also differ in size and structure: 1.RNA molecules are smaller (shorter) than DNA molecules, 2.RNA is single-stranded, not double-stranded like DNA. ･Another difference between RNA and DNA is in function. DNA has only one function-STORING GENETIC INFORMATION in its sequence of nucleotide bases. But there are three main kinds of ribonucleic acid, each of which has a specific job to do. 1.Ribosomal RNAs-exist outside the nucleus in the cytoplasm of a cell in structures called ribosomes. Ribosomes are small, granular structures where protein synthesis takes place. Each ribosome is a complex consisting of about 60% ribosomal RNA (rRNA) and 40% protein. 2.Messenger RNAs-are the nucleic acids that "record" information from DNA in the cell nucleus and carry it to the ribosomes and are known as messenger RNAs (mRNA). 3.Transfer RNAs-The function of transfer RNAs (tRNA) is to deliver amino acids one by one to protein chains growing at ribosomes. Protein Phenotype Amino acids

What makes you YOU? Who you are is generally thought of as what you look like. We all appear different, like the game Guess Who. We have different hair color, eye color, face shape, skin tone, etc. 18

DNA Let’s discuss DNA and how forensic scientists analyze DNA so that you can solve this crime!

How many bases are there in the human genome?
Facts & Figures about DNA How many bases are there in the human genome? 3000 300000 3 billion

Facts & Figures about DNA How many bases are there in the human genome? 3,000 300,000 3 million 3 billion 3 trillion 3000 300000 3 billion

Facts & Figures about DNA How many bases are there in the human genome? 3,000,000,000 3000 300000 3 billion

Facts & Figures about DNA
We are not all exactly the same – What percent of your DNA is similar to any other person in the world? Relate it to evo – ernesto will look up info for animals 99.9

We are not all exactly the same – What percent of your DNA is similar to any other person in the world? 99.9% 98% 90% 60% 10% 99.9 98 – Chimp 90 – mouse 60% - drosophila

Facts & Figures about DNA 3 MILLION bases are different!
We are not all exactly the same – What percent of your DNA is similar to any other person in the world? 3 MILLION bases are different! 99.9 98 – Chimp 90 – mouse 60% - drosophila

Forensic scientists focus on these variable regions to generate a “DNA fingerprint” for each individual 3,000,000,000 bases in the human genome! Only 0.1% differs from one person to the next - see if they can figure out that this is 3,000,000

What are some sources of DNA?
Ask them to name some sources of DNA and list them on the board before you show them this list.

What are some sources of DNA?
Blood Tissue Skin Ear Wax Dandruff Semen Sweat Mucus Hair Urine Ask them to name some sources of DNA and list them on the board before you show them this list. Saliva

Ok forensics scientists… Let’s isolate DNA!
You will now isolate your OWN dna.

DNA Isolation Method Step 1: Add your saliva to the tube
Step 2: Add 1-2 drops of soap to tube and mix well Step 3: Add a pinch of salt and mix well Step 4: Add several droppers full of ethanol and mix well Step 5: Spool your DNA with stick Now that we have this DNA, can you tell the difference between your dna and you’re partners.

How do forensic scientists get so much information from a tiny amount of DNA?
This is how we can solve our crime!

Polymerase Chain Reaction (PCR)
ACGCACTTCAGAACGCGTACTGACTGAA TGCGTGAAGTCTTGCGCATGACTGACTT PCR can make many copies in a very short period of time

ACGCACTTCAGAACGCGTACTGACTGAA TGCGTGAAGTCTTGCGCATGACTGACTT Heat to 94°C: Denature Strands of DNA

ACGCACTTCAGAACGCGTACTGACTGAA TGCGTGAAGTCTTGCGCATGACTGACTT TGCGTGAA TGACTGAA Cool to 55°C: Allow primers to anneal

ACGCACTTCAGAACGCGTACTGACTGAA TGCGTGAAGTCTTGCGCATGACTGACTT TGCGTGAAGTCTTGCGCATGACTGACTT ACGCACTTCAGAACGCGTACTGACTGAA Heat to 72°C: New DNA strand is synthesized

ACGCACTTCAGAACGCGTACTGACTGAA TGCGTGAAGTCTTGCGCATGACTGACTT ACGCACTTCAGAACGCGTACTGACTGAA TGCGTGAAGTCTTGCGCATGACTGACTT ACGCACTTCAGAACGCGTACTGACTGAA TGCGTGAAGTCTTGCGCATGACTGACTT ACGCACTTCAGAACGCGTACTGACTGAA TGCGTGAAGTCTTGCGCATGACTGACTT ACGCACTTCAGAACGCGTACTGACTGAA TGCGTGAAGTCTTGCGCATGACTGACTT ACGCACTTCAGAACGCGTACTGACTGAA TGCGTGAAGTCTTGCGCATGACTGACTT ACGCACTTCAGAACGCGTACTGACTGAA TGCGTGAAGTCTTGCGCATGACTGACTT ACGCACTTCAGAACGCGTACTGACTGAA TGCGTGAAGTCTTGCGCATGACTGACTT ACGCACTTCAGAACGCGTACTGACTGAA TGCGTGAAGTCTTGCGCATGACTGACTT ACGCACTTCAGAACGCGTACTGACTGAA TGCGTGAAGTCTTGCGCATGACTGACTT ACGCACTTCAGAACGCGTACTGACTGAA TGCGTGAAGTCTTGCGCATGACTGACTT ACGCACTTCAGAACGCGTACTGACTGAA TGCGTGAAGTCTTGCGCATGACTGACTT ACGCACTTCAGAACGCGTACTGACTGAA TGCGTGAAGTCTTGCGCATGACTGACTT PCR can make many copies in a very short period of time

How do we generate a DNA fingerprint?
…After amplification of the variable regions through PCR How do we generate a DNA fingerprint?

Restriction Enzyme Digest
DNA can be cut into smaller pieces by restriction enzymes that recognize very specific sequences of DNA. AGCTAGAATTCTTTACGCTCGGATGAATTCCACCTATCTCC Group scissors

Restriction Enzyme Digest
DNA can be cut into smaller pieces by restriction enzymes that recognize very specific sequences of DNA. AGCTAGAATTCTTTACGCTCGGATGAATTCCACCTATCTCC Group scissors AATTCTTTACGCTCGGATG AGCTAG AATTCCACCTATCTCC

Multiple Restriction Enzymes
Exist for Cutting DNA EcoRI GAATTC G AATTC PstI CTGCAG CTGCA G SmaI CCCGGG CCC GGG HindIII AAGCTT A AGCTT BamI GGATCC G GATCC HaeIII GGCC GG CC

Analyzing DNA in an Electrophoresis Gel
An agarose gel is used to analyze the DNA. This gel is a matrix and feels like jello. Describe gel electrophoresis as a jello with very tiny holes. Larger objects have trouble moving through, but smaller ones can move more easily. One suggestion is comparing it to moving through the hallways as classes are changing – its very congested, but the little guy that is smaller than everyone else can move through more easily. Also point out the marker that is used for estimating the size of your DNA. Sometimes you know what sizes to expect, other times you need to use the marker to figure it out.

Marker is loaded in the first lane Describe gel electrophoresis as a jello with very tiny holes. Larger objects have trouble moving through, but smaller ones can move more easily. One suggestion is comparing it to moving through the hallways as classes are changing – its very congested, but the little guy that is smaller than everyone else can move through more easily. Also point out the marker that is used for estimating the size of your DNA. Sometimes you know what sizes to expect, other times you need to use the marker to figure it out.

Samples are loaded in the rest of the lanes of the gel Marker is loaded in the first lane Describe gel electrophoresis as a jello with very tiny holes. Larger objects have trouble moving through, but smaller ones can move more easily. One suggestion is comparing it to moving through the hallways as classes are changing – its very congested, but the little guy that is smaller than everyone else can move through more easily. Also point out the marker that is used for estimating the size of your DNA. Sometimes you know what sizes to expect, other times you need to use the marker to figure it out.

Sample 2 Marker Sample 1 Sample 3 _ Electric current is applied and the negatively charged DNA moves towards the positive end of the gel Describe gel electrophoresis as a jello with very tiny holes. Larger objects have trouble moving through, but smaller ones can move more easily. One suggestion is comparing it to moving through the hallways as classes are changing – its very congested, but the little guy that is smaller than everyone else can move through more easily. Also point out the marker that is used for estimating the size of your DNA. Sometimes you know what sizes to expect, other times you need to use the marker to figure it out. +

Marker Sample 1 Sample 2 Sample 3 _ Electric current is applied and the negatively charged DNA moves towards the positive end of the gel The DNA has to move through the small openings in the matrix of the gel. Which sizes move fastest through the gel? Describe gel electrophoresis as a jello with very tiny holes. Larger objects have trouble moving through, but smaller ones can move more easily. One suggestion is comparing it to moving through the hallways as classes are changing – its very congested, but the little guy that is smaller than everyone else can move through more easily. Also point out the marker that is used for estimating the size of your DNA. Sometimes you know what sizes to expect, other times you need to use the marker to figure it out. +

Sample 1 Sample 2 Marker Sample 3 _ Electric current is applied and the negatively charged DNA moves towards the positive end of the gel The DNA has to move through the small openings in the matrix of the gel. Which sizes move fastest through the gel? 36 24 18 10 Describe gel electrophoresis as a jello with very tiny holes. Larger objects have trouble moving through, but smaller ones can move more easily. One suggestion is comparing it to moving through the hallways as classes are changing – its very congested, but the little guy that is smaller than everyone else can move through more easily. Also point out the marker that is used for estimating the size of your DNA. Sometimes you know what sizes to expect, other times you need to use the marker to figure it out. 7 2 +

Analyzing the DNA _ AGCTAGAATTCTTTAATTGGCGATGAATTCCACCTATCTCC M + 35
25 20 18 Let’s imagine that we are analyzing this piece of DNA being digested by ecor1 – how many pieces of dna, now if we run it on a gel it would look like this. 14 12 8 +

Analyzing the DNA _ AGCTAGAATTCTTTAATTGGCGATGAATTCCACCTATCTCC M 35 25 What are the predicted sizes of the DNA fragments after EcoR1 digestion? 20 18 Let’s imagine that we are analyzing this piece of DNA being digested by ecor1 – how many pieces of dna, now if we run it on a gel it would look like this. 14 12 8 +

Analyzing the DNA _ _ AGCTAGAATTCTTTAATTGGCGATGAATTCCACCTATCTCC M M
35 35 25 25 20 20 AATTCTTTACGCTCGGATG (19) 18 18 Let’s imagine that we are analyzing this piece of DNA being digested by ecor1 – how many pieces of dna, now if we run it on a gel it would look like this. 14 14 AATTCCACCTATCTCC (16) 12 12 8 8 AGCTAG (6) + +

Solving the Crime CRIME SCENE 1 2 3 4 25 35 18 14 8 12 20 MARKER Suspects Because of variations in our DNA sequence, every person has a unique restriction digest pattern, allowing DNA from a crime scene to be matched to a particular suspect. Point out the marker on the gel as well as the crime scene DNA. Ask them which suspect committed the crime by matching the DNA pattern to the crime scene.

Let’s solve the case of the missing mascot!
Point out the marker on the gel as well as the crime scene DNA. Ask them which suspect committed the crime by matching the DNA pattern to the crime scene.

The Suspects

Analyze your suspect’s DNA
EcoRI cuts the following sequence: G|AATTC Match the DNA that

EcoRI cuts the following sequence: G|AATTC Find all EcoRI cut sites in the DNA sequence of the suspect you represent Match the DNA that

EcoRI cuts the following sequence: G|AATTC Find all EcoRI cut sites in the DNA sequence of the suspect you represent Draw the bands on the gel according to their predicted lengths following digestion Match the DNA that

TCGATGAATTCTATCGGAATTCTCGGACTTCTCGAGAATTCTGCGGATTTCTCGGATTCA
Suspect #1: Will Sex: Male Weight: 220 lb. Height: 6’1” Position: Captain of the Football Team M Thief 35 DNA Sequence: TCGATGAATTCTATCGGAATTCTCGGACTTCTCGAGAATTCTGCGGATTTCTCGGATTCA DNA Fragment Sizes: _________________ EcoRI: G|AATTC 30 28 24 20 16 12 10 5 1

1 35 28 24 16 10 12 5 20 DNA Ladder Crime Scene DNA Suspect #1: Will Suspect #2: Natalie Suspect #3: Molly Suspect #4: Jude Suspect #5: Maggie Suspect #6: Vince Suspect #7: Liza 30 (draw a gel like this on your board and fill it out) ****If you don’t have a preprinted poster of a blank gel, make sure you draw a gel on the board for them to fill in if you are using powerpoint. Alternatively, use the blank gel on this slide printed on an overhead ***** Pass out a suspect sheet to each student. Have each student go through and find all the EcoRI cut sites, determine the size of each fragment, and draw the DNA pieces on the gel. Have the students with the same suspect get together and compare their EcoRI digestion analysis. Have one representative from each group go to the board and drawn their digestion pattern on the gel. Identify the thief as a class.

Can we ID the thief?

Please PAUSE and analyze your suspect’s DNA.
Can we ID the thief? Please PAUSE and analyze your suspect’s DNA.

1 35 30 28 24 16 10 12 5 20 DNA Ladder Crime Scene DNA Suspect #1: Will Suspect #2: Natalie Suspect #3: Molly Suspect #4: Jude Suspect #5: Maggie Suspect #6: Vince Suspect #7: Liza (draw a gel like this on your board and fill it out) ****If you don’t have a preprinted poster of a blank gel, make sure you draw a gel on the board for them to fill in if you are using powerpoint. Alternatively, use the blank gel on this slide printed on an overhead ***** Pass out a suspect sheet to each student. Have each student go through and find all the EcoRI cut sites, determine the size of each fragment, and draw the DNA pieces on the gel. Have the students with the same suspect get together and compare their EcoRI digestion analysis. Have one representative from each group go to the board and drawn their digestion pattern on the gel. Identify the thief as a class.

(draw a gel like this on your board and fill it out)
****If you don’t have a preprinted poster of a blank gel, make sure you draw a gel on the board for them to fill in if you are using powerpoint. Alternatively, use the blank gel on this slide printed on an overhead ***** Pass out a suspect sheet to each student. Have each student go through and find all the EcoRI cut sites, determine the size of each fragment, and draw the DNA pieces on the gel. Have the students with the same suspect get together and compare their EcoRI digestion analysis. Have one representative from each group go to the board and drawn their digestion pattern on the gel. Identify the thief as a class.

GUILTY! (draw a gel like this on your board and fill it out)
****If you don’t have a preprinted poster of a blank gel, make sure you draw a gel on the board for them to fill in if you are using powerpoint. Alternatively, use the blank gel on this slide printed on an overhead ***** Pass out a suspect sheet to each student. Have each student go through and find all the EcoRI cut sites, determine the size of each fragment, and draw the DNA pieces on the gel. Have the students with the same suspect get together and compare their EcoRI digestion analysis. Have one representative from each group go to the board and drawn their digestion pattern on the gel. Identify the thief as a class.

Let’s Compare their DNA!
Will: TCGATGAATTCTATCGGAATTCTCGGACTTCTCGAGAATTCTGCGGATTTCTCGGATTCA (6,11,19,24) Natalie: TCGATGAATTCTATCGCAATTCTCGCAATTCTCGAGAATTCTGCGGATTTCTCGGATTCA (6,30,24) Molly: TCGATGAAGTCTATCGGAATTCTCGGAATTCTCGACAATTCTGCGGAATTCTCGGATTCA (17,9,20,14) Jude: TCGATCAATTCTATCGGAATTCTCGGATTTCTCGACAATTCTGCGGAATTCTCGGATTCA (17,29,14) Maggie: TCGATGAATTCTATCGGAATTCTCGGAATTCTCGACAATTCTGCGGAATTCTCGGATTCA (6,11,9,20,14) Vince: TCGATGAATTCTATCGAAATTCTCGGAATTCTCGAGAATCCTGCGGACTTCTCGGATTCA (6,20,34) Liza: TCGATGAACTCTATCGGAATTTTCGGAATTCTCGAGATTTCTGCGGAATTCTCGGATTCA (26,20,14) Note that all individuals had different sequences of DNA, Change red and green! *Check this slide for correctness! non-cut site EcoRI cut site

ETHICAL CONSIDERATIONS
Just read them out load – some questions to discuss in your classroom Make a discussion point for this slide! Possible answers for the teachers to have.

Do you think that it is fair that students are required to submit a DNA sample simply because they are a member of the Senior class? Just read them out load – some questions to discuss in your classroom Make a discussion point for this slide! Possible answers for the teachers to have.

Do you think that it is fair that students are required to submit a DNA sample simply because they are a member of the Senior class? On what basis should people be required to submit a DNA sample in a criminal investigation? Just read them out load – some questions to discuss in your classroom Make a discussion point for this slide! Possible answers for the teachers to have.

Do you think that it is fair that students are required to submit a DNA sample simply because they are a member of the Senior class? On what basis should people be required to submit a DNA sample in a criminal investigation? What are some potential sources for error in such an investigation? Just read them out load – some questions to discuss in your classroom Make a discussion point for this slide! Possible answers for the teachers to have.

Do you think that it is fair that students are required to submit a DNA sample simply because they are a member of the Senior class? On what basis should people be required to submit a DNA sample in a criminal investigation? What are some potential sources for error in such an investigation? Keeping these in mind, do you think that DNA fingerprinting alone provides substantial enough evidence for positive identification of a criminal? Just read them out load – some questions to discuss in your classroom Make a discussion point for this slide! Possible answers for the teachers to have.

Think about TV crime dramas…
What kind of forensic analysis do they do? bite marks ballistics blood spatter handwriting voices tool marks hair fibers DNA These tests are not statistically reliable, but they are still allowed in court. Analysis if based on an expert’s judgment, not hard science. DNA analysis is the only test which is mathematically reliable to place a person at the crime scene. Toobin J. New Yorker 30-35, 2007.

Think about TV crime dramas…
What kind of forensic analysis do they do? bite marks ballistics blood spatter handwriting voices tool marks hair fibers DNA These tests are not statistically reliable, but they are still allowed in court. Analysis if based on an expert’s judgment, not hard science. DNA analysis is the only test which is mathematically reliable to place a person at the crime scene. only evidence which can link a suspect to a crime with mathematical certainty Toobin J. New Yorker 30-35, 2007.

Real World DNA Analysis
CODIS - Combined DNA Index System STR - Short Tandem Repeat Jobling MA, Gill P. Nat Rev Genet. 2004;5:

Real World DNA Analysis
CODIS - Combined DNA Index System STR - Short Tandem Repeat A complete DNA profile is unique to 1 in 100,000,000,000 people! Jobling MA, Gill P. Nat Rev Genet. 2004;5:

Organization dedicated to exonerating wrongfully convicted people through DNA testing.
As of Feb 2016 337 people in the United States have been exonerated thanks to DNA testing; 14 in the state of NC © Innocence Project

From innocenceproject.org
What Happened? More info about this case: From innocenceproject.org

What Do You Think?

SUMMARY

SUMMARY Humans share 99.9% identity in DNA sequence

SUMMARY Humans share 99.9% identity in DNA sequence
Areas of variability are used by forensic scientists to identify individuals

Areas of variability are used by forensic scientists to identify individuals Every person has a unique DNA fingerprint, which helps match DNA from crime scenes and suspects

Areas of variability are used by forensic scientists to identify individuals Every person has a unique DNA fingerprint, which helps match DNA from crime scenes and suspects DNA evidence is the only evidence that can undeniably identify perpetrators of crime

Areas of variability are used by forensic scientists to identify individuals Every person has a unique DNA fingerprint, which helps match DNA from crime scenes and suspects DNA evidence is the only evidence that can undeniably identify perpetrators of crime DNA evidence is important to exonerate wrongly convicted individuals

About the Scientist:

ACGCACTTCAGAACGCGTACTGACTGAA

Similar presentations

Presentation on theme: "ACGCACTTCAGAACGCGTACTGACTGAA"— Presentation transcript:

Similar presentations

About project

Feedback

Log in

Auth with social network:

ACGCACTTCAGAACGCGTACTGACTGAA

Similar presentations

Presentation on theme: "ACGCACTTCAGAACGCGTACTGACTGAA"— Presentation transcript:

Similar presentations

About project

Feedback