1. X inactivation and Practice Questions

2. Dosage effect and X chromosme
Females have two copies of every X-linked gene and males have only one copy, the amount of gene product (protein) encoded by X-linked genes would differ in the two sexes: females would produce twice as much protein as that produced by males. This difference could be highly detrimental because protein concentration plays a critical role in development.
Animals overcome this potential problem through dosage compensation (dosage effect), which equalizes the amount of protein produced by X-linked genes in the two sexes.

3. X-chromosome inactivation in female mammals occurs through heterochromatin formation
Dosage compensation in mammals so that X-linked genes in XX and XY individuals are expressed at same level
Random inactivation of all except one X chromosome in XX
Barr bodies – darkly stained heterochromatin masses observed in somatic cells at interphase
XX person has one Barr body
XXX person has two Barr bodies
XXY person has one Barr body

4. X chromosome mosaicism
In very early embryo, both X chromosomes are active
In humans, random X-inactivation occurs ~ 2 weeks after fertilization
Each embryonic cell decide independently
Some cells have maternal X inactivated, other cells have paternal X inactivated
All cell descendants have the same inactive X
Adult females are mosaic at X-linked genes
In females heterozygous for X-linked mutation:
Some cells have wild-type allele inactivated
Some cells have mutant allele inactivated
MAKE THE DIFFERENCE BETWEEN LIFE AND DEATH!!

5. X-inactivation is initiated by expression of the Xist gene
Xist, X inactivation specific transcript
One of the few genes expressed on the inactive X but is not expressed on the active X
Xist RNA is a large, non-coding, cis-acting regulatory RNA
Binds to the X-chromosome that it was expressed from
Initiates histone modifications (methylation, deacetylation) that result in heterochromatin formation
Deletion of the Xist gene abolishes X inactivation

6. Random inactivation of X chromosomes requires two steps.
first step, the cell assesses,
how many X chromosomes are present.
In the second step,
one X chromosome is (randomly) selected to become the active X chromosome and all others are silenced.
many details of X-chromosome inactivation remain unknown, several genes and sequences that participate in the process have been identified.
a gene called Xist (for X-inactivation-specific transcript).
On the X chromosomes assessed to become inactivated, the Xist gene is active, producing an RNA molecule that coats the X chromosome and inactivates the genes on it, probably by altering chromatin structure.
On the X chromosome assessed to stay active, other genes repress the activity of Xist so that the Xist RNA never coats the X chromosome and genes on this chromosome remain active.

7. Question 1
Write sequence of nucleotides of the second DNA chain, complementary to given bacterial DNA chain; then, determine the nucleotide sequence of mRNA based on written sequence.
3’ – CCAATCATCCTCATGGTCGTGCTCACGTACC – 5’

8. Question 2
How many molecules of phosphoric acid, nitrogenous bases and deoxyribose contains one molecule of DNA that has 3806 T, and that stands for 24% of all nucleotides in DNA?

9. Question 3
One molecule of DNA has length of 4.2 mm, and contains 26% of T. How many other nucleotides, deoxyribose and phosphorus acid that molecule contains?

10. Question 4
How many different nucleotides there is in DNA molecule which contains 60 A, and that represents 15% of all nucleotides?

11. Question 5
Calculate the length of DNA molecule, if it contains respectively A and T nucleotides, and C and G?

12. Question 6 What is hyperchromic effect? What does Tm imply?
Hyperchromicity is the increase of absorbance (optical density) of a material.
DsDNA absorbs less UV light than ssDNA, so when dsDNA is separated, hyperchromicity happens.
Tm is the melting temperature – temperature at which DNA separates.

13. Question 7
Why is Tm related to base composition? Explain your answer!

14. Question 8
The following table lists hypothetical data relative to base ratios of nucleic acid fractions extracted from four different sources. For each one, assess whether the nucleic acid was DNA or RNA, and secondly, whether it would be single-stranded or double-stranded.
Source T G C A U