Presentation is loading. Please wait.

Presentation is loading. Please wait.

Single-Stranded Positive-Sense RNA Single-Stranded Negative-Sense RNA

Published byIra Lucas Modified over 7 years ago

Similar presentations

Presentation on theme: "Single-Stranded Positive-Sense RNA Single-Stranded Negative-Sense RNA"— Presentation transcript:

1 Single-Stranded Positive-Sense RNA Single-Stranded Negative-Sense RNA
Search Analyze Save to Workbench Genomes Genes & proteins Ortholog Groups Immune epitopes 3D protein structure Sequence Features Host Factor Data Custom BLAST Multiple Sequence Alignment Phylogenetic Trees Sequence Variation Genome Annotator Meta-CATS PCR Primer Design Free data and results storage Download Results Store Analysis Parameters Create Working Sets Upload Private Data Save Search Criteria Share with Collaborators Single-Stranded Positive-Sense RNA Caliciviridae Coronaviridae Flaviviridae Hepeviridae Picornaviridae Togaviridae Single-Stranded Negative-Sense RNA Arenaviridae Bunyaviridae Filoviridae Paramyxoviridae Rhabdoviridae Double-Stranded DNA Herpesviridae Poxviridae Double-Stranded RNA Reoviridae

Download ppt "Single-Stranded Positive-Sense RNA Single-Stranded Negative-Sense RNA"

Similar presentations

MOL8002 – Molecular mechanisms of host defence Methods of molecular biology Recognition of nucleic acids hybridization, sequencing, PCR, arrays Protein.

MOL8002 – Molecular mechanisms of host defence Methods of molecular biology Recognition of nucleic acids hybridization, sequencing, PCR, arrays Protein.
Introduction to Virology Lecture Outline u I. Objectives u II. Historical perspective u III. What is a virus –A. Characteristics –B. Comparison to bacteria.

Introduction to Virology Lecture Outline u I. Objectives u II. Historical perspective u III. What is a virus –A. Characteristics –B. Comparison to bacteria.
Genome databases and webtools for genome analysis Become familiar with microbial genome databases Use some of the tools useful for analyzing genome Visit.

Genome databases and webtools for genome analysis Become familiar with microbial genome databases Use some of the tools useful for analyzing genome Visit.
General structure and classification of viruses

General structure and classification of viruses
General properties of viruses 1-They are very small in size, from 20-300 nm 2-They contain one kind of nucleic acid (RNA or DNA) as their genome 3-They.

General properties of viruses 1-They are very small in size, from nm 2-They contain one kind of nucleic acid (RNA or DNA) as their genome 3-They.
HC70AL Spring 2009 An Introduction to Bioinformatics By Brandon Le & Min Chen April 7, 2009.

HC70AL Spring 2009 An Introduction to Bioinformatics By Brandon Le & Min Chen April 7, 2009.
Introduction to Bioinformatics Spring 2008 Yana Kortsarts, Computer Science Department Bob Morris, Biology Department.

Introduction to Bioinformatics Spring 2008 Yana Kortsarts, Computer Science Department Bob Morris, Biology Department.
Copyright © 2010 Pearson Education, Inc. Lectures prepared by Christine L. Case Chapter 13 Viruses, Viroids, and Prions.

Copyright © 2010 Pearson Education, Inc. Lectures prepared by Christine L. Case Chapter 13 Viruses, Viroids, and Prions.
Molecular Evidence Using DNA, RNA or Protein Sequences to Classify Organisms.

Molecular Evidence Using DNA, RNA or Protein Sequences to Classify Organisms.
Genomic Database - Ensembl Ka-Lok Ng Department of Bioinformatics Asia University.

Genomic Database - Ensembl Ka-Lok Ng Department of Bioinformatics Asia University.
UCSC Archaeal genome browser September 19, 2006 David Bernick, Aaron Cozen and Todd Lowe September 19, 2006 David Bernick, Aaron Cozen and Todd Lowe.

UCSC Archaeal genome browser September 19, 2006 David Bernick, Aaron Cozen and Todd Lowe September 19, 2006 David Bernick, Aaron Cozen and Todd Lowe.
13 - Viruses (for more details on pathogens see Ch 24 & 25)

13 - Viruses (for more details on pathogens see Ch 24 & 25)
Visualization of genomic data Genome browsers. UCSC browser Ensembl browser Others ? Survey.

Visualization of genomic data Genome browsers. UCSC browser Ensembl browser Others ? Survey.
Integrated Bioinformatics Data and Analysis Tools for Herpesviridae Viruses in the Virus Pathogen Resource (ViPR) Yun Zhang 1, Brett Pickett 1, Eva Sadat.

Integrated Bioinformatics Data and Analysis Tools for Herpesviridae Viruses in the Virus Pathogen Resource (ViPR) Yun Zhang 1, Brett Pickett 1, Eva Sadat.
Chapter 1 Question? infectious agents of small size and simple composition that can multiply only in living cells. Viruses are obligate intracellular.

Chapter 1 Question? infectious agents of small size and simple composition that can multiply only in living cells. Viruses are obligate intracellular.
Influenza Research Database (IRD): A Web-based Resource for Influenza Virus Data and Analysis Victoria Hunt 1 *, R. Burke Squires 1, Jyothi Noronha 1,

Influenza Research Database (IRD): A Web-based Resource for Influenza Virus Data and Analysis Victoria Hunt 1 *, R. Burke Squires 1, Jyothi Noronha 1,
1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview WWW.IBP.IR پرتال WWW.IBP.IR پرتال بيوانفورماتيك ايرانيان.

1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.
What morphology is this virus?

What morphology is this virus?
1 What are Viruses? Obligate intracellular parasites Viral components –Nucleic acids –Capsid –Envelope.

1 What are Viruses? Obligate intracellular parasites Viral components –Nucleic acids –Capsid –Envelope.
CHAPTER 21 VIRUSES MONERA

CHAPTER 21 VIRUSES MONERA

Similar presentations

Ads by Google