1. Next Generation Sequencing
UNIVERSITA’ DEGLI STUDI DI NAPOLI Federico II
FACOLTA’ DI MEDICINA E CHIRURGIA
CORSO DI LAUREA in MEDICINA
Anno Accademico 2014 – 2015
Next Generation Sequencing

2. Genomic Revolution Gene Expression Microarray
Genome-wide Association Studies
Next Generation Sequencing

3. In this Talk: Next generation sequencing (NGS) NGS applications
Future directions
We’ll talk about 2G and 3G
I’ll mention 2 nice applications of NGS, one of them already in use the second is likely to become industrial in a few years period from now
And finally I’ll mention some of the future directions, both in terms of technology developments and applications. 3

4. Sequencing the Human Genome
2001: Human Genome Project
2.7G$, 11 years 10
2001: Celera
100M$, 3 years
2007: 454
1M$, 3 months 8
2008: ABI SOLiD
60K$, 2 weeks 6
Log10(price)
2010: 5K$, a few days?
2009: Illumina, Helicos
40-50K$
I would like to begin with an overview of the history of human genome sequencing.
Despite significant improvements … it was clear that Sanger sequencing would not make massive DNA sequencing at a low cost and high speed feasible.
Several technologies were developed at the time, of which the 454 Life Sciences sequencer was the first to become commercial in years later it was used for …
Whether …, but the direction is clear: in a few years from now very fast and cheap sequencing technologies will be available for commercial and research purposes 4
2014: 2000$,
Few days 2
2000
2005
2010
Year 4

5. Genome Sequencing Goal
figuring the order of nucleotides across a genome
determines the DNA sequence 5

6. Genome Sequencing
AC..GC
TT..TC
CG..CA
TG..GT
TC..CC
GA..GC
TG..AC
CT..TG
GT..GC
AT..AT
TT..CC
AA..GC
Short DNA sequences
Genome
Short fragments of DNA
ACGTGGTAA CGTATACAC TAGGCCATA GTAATGGCG CACCCTTAG TGGCGTATA CATA…
ACGTGGTAATGGCGTATACACCCTTAGGCCATA
ACGTGACCGGTACTGGTAACGTACA CCTACGTGACCGGTACTGGTAACGT ACGCCTACGTGACCGGTACTGGTAA CGTATACACGTGACCGGTACTGGTA ACGTACACCTACGTGACCGGTACTG GTAACGTACGCCTACGTGACCGGTA CTGGTAACGTATACCTCT...
Sequenced genome 6 6

7. Sanger Sequencing Mix DNA with dNTPs and ddNTPs Amplify Run in Gel
Fragments migrate distance that is proportional to their size 7

8. Sanger Sequencing 8

9. Sanger Sequencing Advantages Disadvantages Long reads (~900bps)
Suitable for small projects
Disadvantages
Low throughput
Expensive
Speed
Low resolution
Scalability 9

10. Sanger Sequencing 2007: Global Ocean Sampling Expedition
~3,000 organisms, 7Gbp (Venter et al.)
1994: H. Influenzae
1.8 Mbp (Fleischmann et al.)
1980
1990
2000
1982: lambda virus
DNA stretches up to Kbp (Sanger et al.)
2001: H. Sapiens, D. Melanogaster
3 Gbp (Venter et al.) 10

12. Next Generation Sequencing
The ability to process millions of sequence reads in parallel
It requires only one or two instruments runs to complete an experiments
Genomic, transcripomic, epigenetic
NGS is a general term refering to all post-Sanger sequencing technologies that enable massive sequencing at low cost.
NGS may be further divided into polony-sequencing based technologies which require the amplification of DNA prior to sequencing, and single molecule sequencing which do not.
Motivation for new technologies drives its roots not only from potentially commercial usage such as in personalised medicine, but also from government supported projects suce as the HGP or the 1000 genomes projects aiming to sequence the genomes of 1000 individuals around the world with price tag for genome sequencing single genomes set to 50,000$.
other than de-novo sequencing Potential applications include re-sequencing, and also gene expression analysis, both can make use of short reads which are offered by all current technologies. So despite the read-length barrier of the new technologies, sequencers still became commercial.
And of course – advancements in chemistry, microscopy and other related technologies enabled the new sequencing technologies. 12 12

13. Whole genome sequencing
determines the complete DNA sequence of an organism's genome at a single time
gDNA is first fragmented into a library of small segments that can be uniformly and accurately sequenced in millions of parallel reactions
De novo sequencing
Re-sequencing

14. Sample Multiplexing
NGS reduces time to data for multiple samples

15. NGS vs Sanger sequencing

17. Types of next generation sequencing
DNAseq
Whole genome sequencing (WGS)
Exome sequencing (1% protein coding portion of human genome) (WES)
Targeted sequencing
RNAseq – transcriptome:
Truly accurate gene expression measurements
Discover novel genes (and other kinds of RNA molecules)
one experiment found that 34% of human transcripts were not from known genes
Sultan et al, Science Aug 15;321(5891):
Chipseq
Select (and identify) pieces of DNA that interact with specific proteins such as:
Transcription factors
Histones
Methylation
RNA Polymerase (survey actively transcribed portions of genome)
DNA Polymerase (investigate DNA replication)
DNA repair enzymes

18. Applications of Next Generation Sequencing
Profiling of Variation
Genetic variation
Transcript variation
Epigenetic variation
Metagenomic variation
Discovery
Novel genomes
Novel genes
Novel transcripts
Small / long non-coding RNA

19. Types of sequencer for NGS
Evolving technology
Illumina HiSeq 2000
Life Technologies SOLiD 4
Ion Torrent PGM
Illumina MiSeq
Pacific Biosciences RS
Roche 454 GS FLX
Roche GS Junior
and then there is the bioinformatics

20. Next Generation Sequencing
454 Life Sciences/Roche
Genome Sequencer FLX: currently produces 0.1GB bases per day per machine
Published 1 million bases of Neanderthal DNA in 2006
May 2007 published complete genome of James Watson (3.2 billion bases ~20x coverage)
Solexa/Illumina
10 GB per machine/week
May 2008 published complete genomes for 3 hapmap subjects (14x coverage)
ABI SOLID
20 GB per machine/week

21. 454 First high-throughput DNA sequencer, commercially
available in 2004
Now produces ~500 MB reads of 500 bp
Run of 8 samples in 10 hours, so can do multiple runs/week
Uses pyrosquencing, beads, and a microtiter plate
Low error rate, but insert/delete problems

22. A parallelized version of pyrosequencing
amplifies DNA inside water droplets in an oil solution (emulsion PCR)
each droplet containing a single DNA template attached to a single primer-coated bead that then forms a clonal colony.
picolitre-volume wells each containing a single bead and sequencing enzymes

23. VIDEO 454 life

24. DNA Sequencing capability has grown exponentially
DNA sequences in GenBank
Doubling time = 18 months

25. Personalized medicine
Goal
Personalized medicine

26. Barack Obama announces Precision Medicine Initiative (PMI)
national investment in research on approaches to disease treatment and prevention that take into account individual variability in each
a) person's genes, b) environment, and c) lifestyle.
So far identified:
3600 genes for rare mendelian disorders,
4000 genetic loci related to common diseases, and
several hundred genes that drive cancer.
FDA must evaluate diagnostic tests for both analytic validity and clinical validity

27. NGS Applications

28. Anthrax contamination Honey-bee epidemic …
Emergency Genomics
SARS virus
Anthrax contamination
Honey-bee epidemic …
Next-Gen sequencing capability is a strategic necessity

29. Ancient DNA paleontology, anthropology, evolutionary biology, conservation biology, epidemiology
Neandertal
Tyrolean Iceman
Woolly Mammoth
Tasmanian wolf
Pathogens
Historical epidemics: flu, tuberculosis
Origins of AIDS
Cause of extinction in some species

30. Resequencing (mutation discovery/genotyping)
A lot of current sequencing effort is spent on re-sequencing genomes of known species
Individual humans (1000 Genomes Project)
Experimental organisms – looking for genetic variation, copy number variation
Challenge is to (quickly) align millions of sequence reads to a reference genome with some % of mismatches
Challenge to accurately call SNPs and indels

31. to sequence the genomes of a large number of people, to provide a comprehensive resource on human genetic variation
The goal of the 1000 Genomes Project is to find most genetic variants that have frequencies of at least 1% in the populations studied

32. Can very quickly sequence bacteria or viral isolates
Pathogens
Can very quickly sequence bacteria or viral isolates
Identify strains – measure frequency in populations
Can find rare variants in a mixed isolate (deep sequencing)
Discover new strains – find precise mutations for drug resistance or increased virulence
Cancer
Sequence tumors from many patients for many different types of cancer

33. ICGC Marker Paper
Nature 464, (15 April 2010)

34. April 2010: World Map of Comprehensive Cancer Genome Projects
Commitments for > 10,000 tumor genomes!
New RFAs/projects in development

36. The results of this project could have enormous relevance to the health of people leading to personalized therapeutics

37. Lung cancer before and after Gefitinib
EGFR inhibitor
You have all probably seen this slide too!
Lung cancer second most common cancer after breast
One of lowest survival rates
Genomics having some success already with treatments - gefitinib
It acts on tumours over expressing EGFR and was approved by NICE in 2010 for lung cancer.
There are now many other dramatic examples of targeted anti-tumour agents

38. BRAF inhibitors for Melanoma
PET
Before
After
Our understanding of cancer is evolving and improving all the time – but we need to do more
Patient with severe melanoma
BRAF inhibitors can improve quality of life and extend it but along way off finding cures

39. Metagenomics
Survey/discovery all of the species present in an Environmental or Medical sample
“Human Microbiome”
disease vs. healthy microbe populations in mouth, intestines, skin, reproductive tract, etc
Complete multiple genome sequencing
Complete multi-species transcript profiling (metabolic reconstruction)
Deep sampling of genetic variation in microbial populations (frequency of drug resistant, toxin producing, etc.)

40. Personalized Nutrition and The Human Microbiome Project (HPM)
Direct and thorough examination of microbial communities has the potential to greatly improve human development, nutrition, physiology, and immunity.
The next-generation sequencing technologies have inspired several studies of bacterial communities that reside on and in the human bodies

41. Example: Obesity
It is associated with changes in the relative abundance of bacterial divisions in both human and moues gut traits
The obese microbiome had an increased capacity to harvest energy from the diet
The gut microbiota as an additional contributing factor to the balance of nutrition, which might have potential theraupetic impliactions
Turnbaugh, et al.
The human microbiome
project.
Nature 2007; 449:
Turnbaugh PJ, et al.
An obesityassociated gut microbiome with increased capacity for energy harvest.
Nature 2006; 444:

42. HPM and Personalized nutrition
New recommendations for food production, distribution and consumption in the future

43. Cleft palate, absent digits, ocular anomalies and others
Exome sequencing
A massively parallel short-read sequencer to sequence at 40 fold coverage
Miller syndrome
Cleft palate, absent digits, ocular anomalies and others

44. Exome sequencing and filtering strategy for rare mendelian disorders

45. eight candidate genes under a dominant model, and only one, DHODH, under a recessive model. The four individuals with Miller syndrome were found to have six rare variants in DHODH

46. This new approach will be critical to uncover the genes underlying rare mendelian traits, especially where the number of available individuals for study is small

47. Rare inherited diseases
Work over the past 25 years: identification of genes for about 50% of the estimated 7,000 rare monogenic diseases
By the year 2020 the remaining disease-causing genes will be identified
The advent of NGS has changed the landscape of rare-genetic-disease research
Rare disease may be rare but collectively they are very common and affect a significant number of the UK population
Mainly affect children, only 50% are provided with a genomic diagnosis
NIHR member of International Rare Disease Research Consortium

48. Pace of discovery of novel rare-disease-causing genes using whole-exome sequencing
Of the more than 300 WES reports in the literature, ~15% that describe novel and distinct phenotypes for mutations in genes that were previously associated with a different rare disease

49. Paths forwards for rare-disease therapy
In Europe: 144 medicinal products for treatment of 120 rare diseases.
In USA: 340 medicinal products for the treatment of 355 different rare disease indications.
This number will increase by NGS discoveries
For instance
Identification of mutations in riboflavin transporter genes SLC52A3 as the cause of Brown–Vialetto–Van Laere syndrome suggests that riboflavin could be used as treatment

50. Rate of approval of orphan drug products
In Europe, there will be approximately
75 new approvals in the next 20 years

51. MiSeqDxTM Cystic Fibrosis Clinical Sequencing Assay
The first FDA-cleared in vitro diagnostic next-generation sequencing assay to provide a complete view of the CFTR gene for increased confidence in cystic fibrosis variant detection.

52. Integrated Clinical Sequencing Assay

53. Visualization Using the MiSeq Reporter Software

54. China FDA Approves BGI NGS Assays Based on Ion Torrent and Complete Genomics NGS Technology
The NGS systems have been approved in conjunction with BGI's noninvasive prenatal diagnostic kit, marketed as NON_INVASIVE_FETAL TRYSOMY_TEST (NIFTY), which screens for fetal aneuploidies in chromosomes 21, 18, and 13.
Cell-Free Fetal DNA in maternal plasma and serum
Short fragments of bp from placenta trophocytes
Detectable in maternal plasma from the 5th week of gestation
Disappears soon after childbirth

56. Future perspectives
Limitation: lack of analyse and share deep phenotypic data and genomic-variation data on a large scale
Human Variome Project:
global initiative to collect and curate all human genetic variation affecting health, with the ultimate goal of reducing disease.
International Standards for Cytogenomic Arrays Consortium
collection of phenotypic data from patients investigated in more than 28,500 array-based studies
PhenoDB and Pheno Tips
free web tools contain clinical data and rare-disease-causing genes.

57. Future perspectives
The medical geneticist of the NGS era will have an unprecedented opportunity to
identify human disease-causing genes,
enable the translation of NGS into diagnostic tools
and understand the role of disease modifiers to advance the care of patients with rare diseases.

58. translation of gene discoveries
Benefits to patients from elucidation of genetic basis of all rare genetic diseases
Understanding molecular mechanisms
Phenotypic heterogeneity
Developing high-throughput or generalizable therapies for many diseases
translation of gene discoveries

59. Predittiva, personalizzata, e preventiva
Genomic Medicine
Predittiva, personalizzata, e preventiva
GRAZIE