1. DNA (5)

2. Who are these guys? And how is DNA important in their lives?

3. A NYC Case Example

4. Sexual Assault in Building Hallway

5. Blood-soaked victim's shirt

9. Case Facts:
Person seen running from scene
ID of person made by tenant
Police arrest suspect
Suspect found to have prior history of sexual assault
Suspect confesses
Rape kit is negative for semen

10. DNA Testing Results
Blood stains on stairs do not match suspect
Local DNA database found a match with a semen stain from another case
Similar modus operandi and nearby location
Suspect identified in other case
DNA match with semen of other case

11. Did suspect have an accomplice?

12. Epilogue
Mixtures of DNA from victim and perpetrator found in bloodstain from victim’s clothing
Suspect’s DNA not found on clothing or crime scene
Charges dropped against suspect

13. What is DNA?

14. Functions of DNA
To transmit information from one generation of cells to the next
To provide the information for the synthesis of components (proteins) necessary for cellular function

16. What does DNA look like?

18. Chromosomes
In most types of cells, genetic information is organized into structures called chromosomes
1 pair of sex chromosomes
22 pairs of autosomes in humans

19. Chromosomes
Each chromosome has a single molecule of DNA bound to Histones
if fully extended the molecule would be about 1.7 meters long
unwrapping all the DNA in all your cells
cover the distance from earth to moon 6,000 times

20. Genes
Each chromosome contains hundreds to thousands information blocks called genes
Each gene is the blueprint for a specific type of protein in the body
only identical twins will have all the genes identical

21. What is DNA made of?

22. Nucleotides DNA is a polymer built from monomers called nucleotides
Each nucleotide is consists of
deoxyribose
pentose sugar
phosphoric acid
a nitrogenous base

23. The DNA Backbone
The monomers are linked together by phosphodiester bridges (bonds)
links the 3’ carbon in the deoxyribose of one nucleotide to the 5’ carbon in the deoxyribose of the adjacent nucleotide

24. The DNA Double Helix DNA is normally a double stranded macromolecule
Two polynucleotide chains are held together by H-bonding
A always pairs with T
C always pairs with G

25. Base Pairing of DNA Strands
A = T
G  C
T = A
C  G T C A G 5’ 3’
denatured
strands
hybridized
Hydrogen bonds
Phosphate-sugar backbone

26. 5’ T-T-G-A-C-T-A-T-C-C-A-G-A-T-C 3’
3’ A-A-C-T-G-A-T-A-G-G-T-C-T-A-G 5’
In a double helix the strands go in opposite directions

27. Sources of DNA Blood and blood stains Semen and semen stains Bones
Teeth
Hair with roots
Hair shaft
Saliva (containing nucleated cells)
Urine
Feces
Debris from fingernail scrapings
Muscle Tissue
Cigarette butts
Postage stamps
Envelope sealing flaps
Dandruff
Fingerprints
Personal Items:
razor blade, chewing gum, toothbrush, lipstick stains
Adopted from Butler, J.M. (2001) Forensic DNA Typing, Table 3.1, ©Academic Press

28. Where are the types of DNA found in a cell?
Mitochondrial DNA
Nuclear DNA

29. DNA BASICS Genomic DNA as hereditary material
-found in the nucleus of the cell (nuclear DNA)
Determines physical characteristics of people
Half the DNA is maternal/half the DNA is paternal

30. DNA BASICS Genomic DNA is found in every nucleic cell in the body
Genomic DNA is the same in all cells
Genomic DNA does not change throughout one’s lifetime

31. DNA BASICS
No two people (except identical twins) have exactly the same DNA
-not really true about twins…
DNA doesn’t change over time
Can get DNA from any cell
Mostly the same between people, but small regions vary between individuals
Less than 0.1% of DNA is unique

32. What we can’t tell from forensic DNA testing…..
When it was left at scene
Race- (now we can!)
Age of person
Diseases (unless genetic!)
How it got there (ex. Rape vs. Concentual sex)

33. DNA Extraction Organic Method
INCUBATE (56 oC)
Centrifuge
Blood stain
SDS, DTT, EDTA and
proteinase K
Phenol,
chloroform,
isoamyl alcohol
VORTEX
Centrifuge
TRANSFER aqueous (upper) phase to new tube
TE buffer
CONCENTRATE sample (Centricon/Microcon-100 or ethanol precipitation)
Centrifuge
QUANTIFY DNA
PERFORM PCR

34. Differential Isolation of DNA
Semen stain
Epithelial DNA
Sperm DNA
Chemical
Semen stain
Different Chemical
Remove
Epithelial
DNA
Sperm
DNA

35. Amplification
(making copies)
DNA
Solution

36. PCR Polymerase Chain Reaction=Simulated Natural DNA replication
Copy sections of DNA. Not the whole DNA molecule

37. PCR

38. “DENATURE” Step
Step one of a single cycle G T A C
Heat T G C A

39. “ANNEAL” Step
Step two of a single cycle A T G T A C

40. “EXTEND” Step
Step three of a single cycle C A G T A T G A T G A T A C

41. Thermal Cycling Temperatures
94 oC
94 oC
94 oC
94 oC
Single Cycle
72 oC
72 oC
72 oC
Temperature
60 oC
60 oC
60 oC
Time
Typically cycles performed during PCR
94oC - Denaturation
60oC - Annealing
72oC - Extension

42. Number of Target Molecules Created1 2 3 4 5 8 6 16 7 32 64 9
128 10
256 11
512 12
1024 13
2048 14
4096 15
8192
16,384 17
32,768 18
65,536 19
131,072 20
262,144 21
524,288 22
1,048,576 23
2,097,152 24
4,194,304 25
8,388,608 26
16,777,216 27
33,544,432 28
67,108,864 29
134,217,728 30
268,435,456 31
536,870,912
1,073,741,824
Cycle Number
Number of Double-stranded Target Molecules

43. Advantages of PCR Need very small amounts of biological material
Minute amounts of DNA template may be used (i.e., 3 uL whole blood, 2-3 mm bloodstain cutting)
Can be used with forensic samples
DNA degraded to fragments only a few hundred base pairs in length can serve as effective templates for amplification.
Contaminant DNA, such as fungal and bacterial sources, will not amplify because human-specific primers are used.

44. Now the fun begins!-Whose DNA is it?

45. Why we do analyze DNA?
Forensic cases -- matching suspect with evidence
Paternity testing -- identifying father
Historical investigations-Czar Nicholas, Jesse James, Genealogy
Missing persons investigations
Mass disasters -- putting pieces back together
Military DNA “dog tag”
Convicted felon DNA databases

46. Challenges of DNA Analysis
Mixtures of DNA must be resolved (ie. separated)
DNA could be degraded
There could be contaminants that interfere with PCR

47. How do we compare DNA?

48. 1980s-RFLP Technique (PCR not readily available)

49. What are the probes looking for?
Variable Number Tandem Repeats (VNTR)
can contain anywhere from 20 to 200 base pairs
In Intron Region of DNA (-not Exon Region)
Inherited from mom and dad

50. After probing electrophoresis products

51. Real RFLP Analysis
Measurements taken of fragments that vary in length across people (length polymorphism) because they contain VNTRs

52. Problems with RFLP (Restriction Fragment Length Polymorphism)
Need a lot of DNA
Takes a long time to process the DNA (ie weeks)
Sensitive to contamination

53. Late1990s PCR-STR Technique
Benefits:
Results in 2-3 days (-but in real world, results not back for 6-10 weeks because of workload)
Small DNA sample needed
Very specific-not affected by contaminants

54. STR (Short Tandem Repeats)

55. STRs
On Chromosome 5, there’s a repeat region called CSF1PO. At this site, the sequence “AGAT” is repeated.
For one person it might be repeated 7 times:
…AGATAGATAGATAGATAGATAGATAGAT…
while for others it might be repeated 5 times:
…AGATAGATAGATAGATAGAT…

56. Short Tandem Repeats (STRs)
Fluorescent dye tags
AATG
AATG
7 repeats
8 repeats
the repeat region is variable between samples while the flanking regions where PCR primers bind are constant
Primer positions define PCR product size

57. STR DNA Analyzer
Amplified
DNA
DNA
Profile

58. DNA Fingerprint

59. Mitochondrial DNA
What is mtDNA Typing?
Circular like bacteria

60. Benefits at looking at mDNA
More resistant to decay
Lasts longer than genomic DNA
Many copies

61. Advances in DNA Fingerprinting
CODIS
DNA Chips
Geotracking

62. FBI’s CODIS DNA Database
Combined DNA Index System
Used for linking serial crimes and unsolved cases with repeat offenders
Launched October 1998
Links all 50 states
Requires >4 RFLP markers
and/or 13 core STR markers
Current backlog of >600,000 samples

63. Cold Hits and Solved Cases
On August 25, 1979, an 8-year old girl was brutally raped and murdered in San Pablo, CA. Semen was collected from the body and placed in an evidence room, where it sat for 22 years. Through this program, a DNA profile
was made and submitted to the state and federal databases. This resulted in a “cold hit” identifying Joseph Cordova Jr. as the suspect. Cordova was a habitual child molester who at the time of the DNA analysis was incarcerated in a Colorado prison. Cordova was subsequently charged with molesting, raping and murdering the 8-year old girl.

64. On November 8, 2000, a 12 year old girl, was kidnapped off of the street in Rancho Cordova, CA, and driven to Feather River in Sutter County where she was sexually assaulted and then killed. Nine months later, Justin Weinberger was stopped for a traffic violation in New Mexico. A check by police revealed that Weinberger was wanted on a federal warrant for child pornography. He was detained and voluntarily provided a DNA sample. Analysis of that DNA sample resulted in a match with evidence identifying Weinberger as the suspect in this case. Weinberger was subsequently extradited to California where he was tried and convicted of the murder of the 12-year old girl.

66. STR Analysis by Hybridization on Microchips

67. Geo-Tracking DNA
Missile cache found by CIA in Pakistan
Swab packaging from outside to inside
Obtain human, insect, fungal, plant DNA
Analysis of DNA alone determined:
shipment originated in Syria
Stayed in Iran
Then came to Pakistan

68. Brief Historical Review of DNA Typing
Ray White describes first polymorphic RFLP marker
Alec Jeffreys discovers multilocus VNTR probes
first paper on PCR
FBI starts DNA casework
first STR paper
FSS starts UK DNA database
FBI launches CODIS database