1. Mark Bergland and Karen Klyczek, University of Wisconsin-River Falls
Case It:  An Effective Tool for Case-based Learning and Undergraduate Research in Molecular Biology
Mark Bergland and Karen Klyczek, University of Wisconsin-River Falls
QUBES workshop, Michigan State University, 2017

2. Session overview
Introduction to the Case It! project and ScienceCaseNet
Examples of undergraduate research applications
HHMI SEA-PHAGES
Color vision in primates (integration with EVO-ED)
Honey bee bioinformatics
Discussion of potential use in BioQUEST projects
Case It! Mobile as an alternative to the Case It! simulation

3. History of the Case It project
1993 AMCBT meeting – John Jungck
1994 BioQUEST workshop - Peter Woodruff
1995 BioQUEST workshop - Joyce Cadwallader, Virginia Carson, and Bill Coleman
1996 BioQUEST workshop – Margaret Waterman
2006 and 2007 BioQUEST workshops – Arlin Toro, Rafael Tosado-Acevedo, Chi-cheng Lin, Dinitra White
2008 and 2009 SCOPE workshops – Ethel Stanley and Sam Donovan
2012 The Science Case Network (RCN-UBE)
2012, 2013 BioQUEST workshops
2016 Collaboration with EvoEd project – Jim Smith, Peter White

4. Overview of Case It Project
Electronic framework for analyzing and discussing case studies in molecular biology
Genetic and infectious diseases and associated ethical issues
Students gather background information on cases
Analyze DNA and protein sequences using the Case It simulation (v6.07)
Can extend case analysis using bioinformatics software and web sites (MEGA and MAFFT)
We have used online poster sessions and role-playing, but there are many other ways to use software and cases

5. Features of Case It v6.07 for PC and Mac
DNA and protein electrophoresis
Restriction enzyme digestion and mapping
Southern, Dot and Western blotting
Polymerase Chain Reaction (single and multiplex)‏
qPCR under development – Case It v7.0
ELISA
Microarrays (SNP and expression)
BLAST, alignments and tree-building (in conjunction with MEGA software (PC) or MABL web site (PC and Mac))
Used to analyze case studies in genetic and infectious diseases and other biology topics

6. Case It! Project links Case It! Home Page: www.caseitproject.org
Includes tutorials, downloads, case descriptions, suggestions for class use, link to Science article
Case It! is part of the ScienceCaseNet network for case and problem-based learning, funded by RCN-UBE program of NSF
Contact:
Case It! funding was provided by the CCD/CCLI/TUES
programs of the National Science Foundation

7. Case It! project collaborators
Mary Lundeberg, Biology Department, University of Wisconsin-River Falls
Chi-Cheng Lin, Computer Science Department,Winona State University
Arlin Toro, Biology Department, Inter American University of Puerto Rico-San German campus
Rafael Tosado, Medical Technology Program, Inter American University of Puerto Rico-Metropolitan Campus
C. Dinitra White, Biology Department, North Carolina A&T State University

8. Session overview
Introduction to the Case It! project and ScienceCaseNet
Examples of undergraduate research applications
HHMI SEA-PHAGES
Color vision in primates (integration with EVO-ED)
Honey bee bioinformatics
Discussion of potential use in BioQUEST projects
Case It! Mobile as an alternative to the Case It! simulation

9. Authentic research for first-year students: HHMI SEA-PHAGES Project
Fall semester
Isolate mycobacteriophages from soil
Isolate phage DNA and analyze by restriction enzyme digestion
Select one phage to send for sequencing
Spring semester – phage genomics (
Annotate genes
Comparative genomics
Research projects on phage biology

10. Abrogate lab gel Abrogate virtual gel Bxb1 virtual gel
L=1 kb ladder; U=undigested; B=BamHI; C=ClaI; E=EcoRI H=HindIII

11. Left to right: 1 kb ladder, undigested, BamHI, ClaI, EcoRI, HindIII
Cluster A phages, listed by subcluster
A1 Perseus
A1 Abrogate
A2 SemperFi
A3 JHC117
A3 Rockstar
A4 MeeZee
A4 Dhanush
A5 Cuco
A6 McFly
A7 Timshel
A8 Astro
A9 Packman
A10 Rebeuca
A10 Trike
Left to right: 1 kb ladder, undigested, BamHI, ClaI, EcoRI, HindIII

12. Session overview
Introduction to the Case It! project and ScienceCaseNet
Examples of undergraduate research applications
HHMI SEA-PHAGES
Color vision in primates (integration with EVO-ED)
Honey bee bioinformatics
Discussion of potential use in BioQUEST projects
Case It! Mobile as an alternative to the Case It! simulation

13. Monkeys of the World http://www.evo-ed.org/Pages/Primates/index.html
Slide from EVO-ED Powerpoint – “Monkey Opsin Evolution”

14. The Role of Opsins
There are three types of opsins: Short Wave Sensitive (SWS) Medium Wave Sensitive (MWS) Long Wave Sensitive (LWS) An individual possessing only SWS and MWS opsins will have dichromatic vision. An individual possessing SWS, MWS and LWS opsins will have trichromatic vision.
Slide from EVO-ED Powerpoint – “Monkey Opsin Evolution”

15. Chromatic Vision: Opsins
3D Visualization
2D Visualization
The opsin protein is composed of a string of amino acids.
Each green dot in the 2D visualization represents one amino acid.
Slide from EVO-ED Powerpoint – “Monkey Opsin Evolution”

16. Opsin Structure MWS LWS opsin opsin
The LWS opsin differs from the MWS opsin in three significant places in the amino acid sequence:
Position 180: alanine to serine
Position 277: phenylalanine to tyrosine
Position 285: alanine to threonine
Slide from EVO-ED Powerpoint – “Monkey Opsin Evolution”

17. Opsin Response to Light
The responses to light of each opsin protein (S, M and L) in trichromats are shown to the right. Note how similar the curves look for M and L. The L curve is shifted by about 30 nm response maximum to the right (longer wavelength).
Slide from EVO-ED Powerpoint – “Monkey Opsin Evolution”

18. Differences at positions 277 and 285 result in spectral shifts of +16-24nm
maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvviasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis vvnqvygyfv lghpmcvleg ytvslcgitg lwslaiiswe rwmvvckpfg nvrfdaklai vgiafswiwa avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccit plsiivlcyl qvwlairava kqqkesestq kaekevtrmv vvmvlafcfc wgpyaffacf aaanpgypfh plmaalpaff aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa
MWS GENE
maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm
ifvvtasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis ivnqvsgyfv
lghpmcvleg ytvslcgitg lwslaiiswe rwlvvckpfg nvrfdaklai vgiafswiws
avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccii plaiimlcyl
qvwlairava kqqkesestq kaekevtrmv vvmifaycvc wgpytffacf aaanpgyafh plmaalpayf aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa
LWS GENE
Different amino acids positions 277 and 285 within the protein changes the function of the protein so that it is maximally stimulated as a higher wavelength of light.
Slide from EVO-ED Powerpoint – “Monkey Opsin Evolution”

19. A change from alanine to serine at position 180 results in an additional spectral shift of 3-7nm.
maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvviasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis vvnqvygyfv lghpmcvleg ytvslcgitg lwslaiiswe rwmvvckpfg nvrfdaklai vgiafswiwa avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccit plsiivlcyl qvwlairava kqqkesestq kaekevtrmv vvmvlafcfc wgpyaffacf aaanpgypfh plmaalpaff aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa
MWS GENE
maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm
ifvvtasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis ivnqvsgyfv
lghpmcvleg ytvslcgitg lwslaiiswe rwlvvckpfg nvrfdaklai vgiafswiws
avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccii plaiimlcyl
qvwlairava kqqkesestq kaekevtrmv vvmifaycvc wgpytffacf aaanpgyafh plmaalpayf aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa
LWS GENE
Different amino acids at position 180 changes the function of the protein so that it is maximally stimulated as a higher wavelength of light.
Slide from EVO-ED Powerpoint – “Monkey Opsin Evolution”

20. MWS Opsin Gene vs. LWS Opsin Gene (mutations at the nucleotide level that result in protein functional changes)
G  T T  A G  A
Three simple substitution mutations change the properties of the opsin protein.
Now, rather than being maximally stimulated at ~534nm, the resulting opsin protein is maximally stimulated at ~564nm.
Slide from EVO-ED Powerpoint – “Monkey Opsin Evolution”

21. MWS Opsin Gene vs. LWS Opsin Gene (mutations at the nucleotide level that result in protein functional changes)
atggcccagcagtggagcctccaaaggctcgcaggccgccatccgcaggacagctatgaggacagcacccagtccagcatcttcacctacaccaacagcaactccaccagaggccccttcgaaggcccgaattaccacatcgctcccagatgggtgtaccacctcaccagtgtctggatgatctttgtggtcattgcatccgtcttcacaaatgggcttgtgctggcggccaccatgaagttcaagaagctgcgccacccgctgaactggatcctggtgaacctggcggtcgctgacctggcagagaccgtcatcgccagcactatcagcgttgtgaaccaggtctatggctacttcgtgctgggccaccctatgtgtgtcctggagggctacaccgtctccctgtgtgggatcacaggtctctggtctctggccatcatttcctgggagaggtggctggtggtgtgcaagccctttggcaatgtgagatttgatgccaagctggccatcgtgggcattgccttctcctggatctgggctgctgtgtggacagccccgcccatctttggttggagcaggtactggccccacggcctgaagacttcatgcggcccagacgtgttcagcggcagctcgtaccccggggtgcagtcttacatgattgtcctcatggtcacctgctgcatcaccccactcagcatcatcgtgctctgctacctccaagtgtggctggccatccgagcggtggcaaagcagcagaaagagtctgaatccacccagaaggcagagaaggaagtgacgcgcatggtggtggtgatggtcctggcattctgcttctgctggggaccatacgccttcttcgcatgctttgctgctgccaaccctggctaccccttccaccctttgatggctgccctgccggccttctttgccaaaagtgccactatctacaaccccgttatctatgtctttatgaaccggcagtttcgaaactgcatcttgcagcttttcgggaagaaggttgacgatggctctgaactctccagcgcctccaaaacggaggtctcatctgtgtcctcggtatcgcctgcatga
MWS GENE
atggcccagcagtggagcctccaaaggctcgcaggccgccatccgcaggacagctatgaggacagcacccagtccagcatcttcacctacaccaacagcaactccaccagaggccccttcgaaggcccgaattaccacatcgctcccagatgggtgtaccacctcaccagtgtctggatgatctttgtggtcattgcatccgtcttcacaaatgggcttgtgctggcggccaccatgaagttcaagaagctgcgccacccgctgaactggatcctggtgaacctggcggtcgctgacctggcagagaccgtcatcgccagcactatcagcgttgtgaaccaggtctatggctacttcgtgctgggccaccctatgtgtgtcctggagggctacaccgtctccctgtgtgggatcacaggtctctggtctctggccatcatttcctgggagaggtggctggtggtgtgcaagccctttggcaatgtgagatttgatgccaagctggccatcgtgggcattgccttctcctggatctggtctgctgtgtggacagccccgcccatctttggttggagcaggtactggccccacggcctgaagacttcatgcggcccagacgtgttcagcggcagctcgtaccccggggtgcagtcttacatgattgtcctcatggtcacctgctgcatcaccccactcagcatcatcgtgctctgctacctccaagtgtggctggccatccgagcggtggcaaagcagcagaaagagtctgaatccacccagaaggcagagaaggaagtgacgcgcatggtggtggtgatggtcctggcatactgcttctgctggggaccatacaccttcttcgcatgctttgctgctgccaaccctggctaccccttccaccctttgatggctgccctgccggccttctttgccaaaagtgccactatctacaaccccgttatctatgtctttatgaaccggcagtttcgaaactgcatcttgcagcttttcgggaagaaggttgacgatggctctgaactctccagcgcctccaaaacggaggtctcatctgtgtcctcggtatcgcctgcatga
LWS GENE
This slide looks at the code of the opsin GENES whereas the previous slides examined the respective protein compositions.
Taking a closer look at the three nucleotide mutations that resulted in changes in amino acids at positions 180, 277 and 285 that lead to a +31nm change in spectral sensitivity.
This is the amino acid sequence of the MWS and LWS opsin genes. These sequences were taken from
Slide from EVO-ED Powerpoint – “Monkey Opsin Evolution”

22. MWS Opsin Gene vs. LWS Opsin Gene (mutations at the nucleotide level that result in protein functional changes)
atggcccagcagtggagcctccaaaggctcgcaggccgccatccgcaggacagctatgaggacagcacccagtccagcatcttcacctacaccaacagcaactccaccagaggccccttcgaaggcccgaattaccacatcgctcccagatgggtgtaccacctcaccagtgtctggatgatctttgtggtcattgcatccgtcttcacaaatgggcttgtgctggcggccaccatgaagttcaagaagctgcgccacccgctgaactggatcctggtgaacctggcggtcgctgacctggcagagaccgtcatcgccagcactatcagcgttgtgaaccaggtctatggctacttcgtgctgggccaccctatgtgtgtcctggagggctacaccgtctccctgtgtgggatcacaggtctctggtctctggccatcatttcctgggagaggtggctggtggtgtgcaagccctttggcaatgtgagatttgatgccaagctggccatcgtgggcattgccttctcctggatctgtgGGctgctgtgtggacagccccgcccatctttggttggagcaggtactggccccacggcctgaagacttcatgcggcccagacgtgttcagcggcagctcgtaccccggggtgcagtcttacatgattgtcctcatggtcacctgctgcatcaccccactcagcatcatcgtgctctgctacctccaagtgtggctggccatccgagcggtggcaaagcagcagaaagagtctgaatccacccagaaggcagagaaggaagtgacgcgcatggtggtggtgatggtcctggcatTctgcttctgctggggaccatacGccttcttcgcatgctttgctgctgccaaccctggctaccccttccaccctttgatggctgccctgccggccttctttgccaaaagtgccactatctacaaccccgttatctatgtctttatgaaccggcagtttcgaaactgcatcttgcagcttttcgggaagaaggttgacgatggctctgaactctccagcgcctccaaaacggaggtctcatctgtgtcctcggtatcgcctgcatga
MWS GENE
atggcccagcagtggagcctccaaaggctcgcaggccgccatccgcaggacagctatgaggacagcacccagtccagcatcttcacctacaccaacagcaactccaccagaggccccttcgaaggcccgaattaccacatcgctcccagatgggtgtaccacctcaccagtgtctggatgatctttgtggtcattgcatccgtcttcacaaatgggcttgtgctggcggccaccatgaagttcaagaagctgcgccacccgctgaactggatcctggtgaacctggcggtcgctgacctggcagagaccgtcatcgccagcactatcagcgttgtgaaccaggtctatggctacttcgtgctgggccaccctatgtgtgtcctggagggctacaccgtctccctgtgtgggatcacaggtctctggtctctggccatcatttcctgggagaggtggctggtggtgtgcaagccctttggcaatgtgagatttgatgccaagctggccatcgtgggcattgccttctcctggatctggTctgctgtgtggacagccccgcccatctttggttggagcaggtactggccccacggcctgaagacttcatgcggcccagacgtgttcagcggcagctcgtaccccggggtgcagtcttacatgattgtcctcatggtcacctgctgcatcaccccactcagcatcatcgtgctctgctacctccaagtgtggctggccatccgagcggtggcaaagcagcagaaagagtctgaatccacccagaaggcagagaaggaagtgacgcgcatggtggtggtgatggtcctggcatActgcttctgctggggaccatacAccttcttcgcatgctttgctgctgccaaccctggctaccccttccaccctttgatggctgccctgccggccttctttgccaaaagtgccactatctacaaccccgttatctatgtctttatgaaccggcagtttcgaaactgcatcttgcagcttttcgggaagaaggttgacgatggctctgaactctccagcgcctccaaaacggaggtctcatctgtgtcctcggtatcgcctgcatga
LWS GENE
This slide looks at the code of the opsin GENES whereas the previous slides examined the respective protein compositions.
Taking a closer look at the three nucleotide mutations that resulted in changes in amino acids at positions 180, 277 and 285 that lead to a +31nm change in spectral sensitivity.
This is the amino acid sequence of the MWS and LWS opsin genes. These sequences were taken from
Slide from EVO-ED Powerpoint – “Monkey Opsin Evolution”

23. Ecology: Why Trichromatic Vision?
DICHROMATIC VISION
TRICHROMATIC VISION
With trichromatic vision, distinguishing between important colors becomes possible.
Slide from EVO-ED Powerpoint – “Monkey Opsin Evolution”

24. Food Selection – The Driver of Trichromacy Evolution?
Slide from EVO-ED Powerpoint – “Monkey Opsin Evolution”

25. What are some other possible reasons for differences in color vision in primates? If you were to design a ‘problem space’ for student investigations on this topic, what components should be included?

26. Highly polymorphic colour vision in a New World monkey with red facial skin, the bald uakari (Cacajao calvus).
Corso et al Proc. R. Soc. B
Abstract: ”Colour vision is highly variable in New World monkeys (NWMs). Evidence for the adaptive basis of colour vision in this group has largely centred on environmental features such as foraging benefits for differently coloured foods or predator detection, whereas selection on colour vision for sociosexual communication is an alternative hypothesis that has received little attention.
The colour vision of uakaris (Cacajao) is of particular interest because these monkeys have the most dramatic red facial skin of any primate, as well as a unique fission/fusion social system and a specialist diet of seeds. Here, we investigate colour vision in a wild population of the bald uakari, C. calvus, by genotyping the X-linked opsin locus. We document the presence of a polymorphic colour vision system with an unprecedented number of functional alleles (six), including a novel allele with a predicted maximum spectral sensitivity of 555 nm. This supports the presence of strong balancing selection on different alleles at this locus.
We consider different hypotheses to explain this selection. One possibility is that trichromacy functions in sexual selection, enabling females to choose high-quality males on the basis of red facial coloration. In support of this, there is some evidence that health affects facial coloration in uakaris, as well as a high prevalence of blood-borne parasitism in wild uakari populations. Alternatively, the low proportion of heterozygous female trichromats in the population may indicate selection on different dichromatic phenotypes, which might be related to cryptic food coloration. We have uncovered unexpected diversity in the last major lineage of NWMs to be assayed for colour vision, which will provide an interesting system to dissect adaptation of polymorphic trichromacy.”

27. Examples of directed activities:
Problem space: DNA samples used in the study, a table giving SNPs for different locations on exons of the opsin gene, primers used to isolate exons 3 and 5, and research studies related to color vision in primates.
Examples of directed activities:
Verify that primers published in the study do in fact isolate exon 3 and 5 of the opsin gene for this primate.
Verify codons associated with functional sites in Table S1 of Corso et al
Verify how ‘inferred alleles’ in Corso et al were determined, using information from Bunce et al
Going through these verifications reinforces basic concepts and helps students understand the research basis of information provided in Evo-Ed materials, prior to conducting open-ended activities on color vision in primates.
Examples of open-ended activities:
Run BLAST using the forward primer site of exon 3 for the bald ukari to see what other primate species match that primer site, and determine from SNP analysis if these primates have the functional sites associated with dichromatic or trichromatic vision (e.g. the moustached tamarin).
Use multiple alignment and tree-building to determine relationships among primates, and relate to vision, behavior, and ecology.

28. Using Case It v6.07 to verify primer sites for the bald uakari study - Corso et at (Example below shows forward primer site for exon 5 of the opsin gene)

29. Examples of directed activities:
Problem space: DNA samples used in the study, a table giving SNPs for different locations on exons of the opsin gene, primers used to isolate exons 3 and 5, and research studies related to color vision in primates.
Examples of directed activities:
Verify that primers published in the study do in fact isolate exon 3 and 5 of the opsin gene for this primate.
Verify codons associated with functional sites in Table S1 of Corso et al
Verify how ‘inferred alleles’ in Corso et al were determined, using information from Bunce et al
Going through these verifications reinforces basic concepts and helps students understand the research basis of information provided in Evo-Ed materials, prior to conducting open-ended activities on color vision in primates.
Examples of open-ended activities:
Run BLAST using the forward primer site of exon 3 for the bald ukari to see what other primate species match that primer site, and determine from SNP analysis if these primates have the functional sites associated with dichromatic or trichromatic vision (e.g. the moustached tamarin).
Use multiple alignment and tree-building to determine relationships among primates, and relate to vision, behavior, and ecology.

30. Table S1 from Corso et al. 2016, in part

31. Using Case It v6.07 to verify codon associated with alanine (A) at position 180 of exon 3 for sample 20F

32. Using Case It v6.07 to verify codon associated with serine (S) at position 180 of exon 3 for sample 43F

33. Examples of directed activities:
Problem space: DNA samples used in the study, a table giving SNPs for different locations on exons of the opsin gene, primers used to isolate exons 3 and 5, and research studies related to color vision in primates.
Examples of directed activities:
Verify that primers published in the study do in fact isolate exon 3 and 5 of the opsin gene for this primate.
Verify codons associated with functional sites in Table S1 of Corso et al
Verify how ‘inferred alleles’ in Corso et al were determined, using information from Bunce et al
Going through these verifications reinforces basic concepts and helps students understand the research basis of information provided in Evo-Ed materials, prior to conducting open-ended activities on color vision in primates.
Examples of open-ended activities:
Run BLAST using the forward primer site of exon 3 for the bald ukari to see what other primate species match that primer site, and determine from SNP analysis if these primates have the functional sites associated with dichromatic or trichromatic vision (e.g. the moustached tamarin).
Use multiple alignment and tree-building to determine relationships among primates, and relate to vision, behavior, and ecology.

34. Opsin Response to Light (from EVO-ED Powerpoint – “Monkey Opsin Evolution”)
The responses to light of each opsin protein (S, M and L) in trichromats are shown to the right. Note how similar the curves look for M and L. The L curve is shifted by about 30 nm response maximum to the right (longer wavelength).

35. Amino acid sites associated with inferred alleles, from Corso et al

36. Table 1 from Bunce et al. 2011, used by Corso et al
Table 1 from Bunce et al. 2011, used by Corso et al to determine inferred alleles for color vision in the bald uakari (see next slide)

37. Inferred vision associated with inferred alleles, Corso et al. 2016

38. Examples of directed activities:
Problem space: DNA samples used in the study, a table giving SNPs for different locations on exons of the opsin gene, primers used to isolate exons 3 and 5, and research studies related to color vision in primates.
Examples of directed activities:
Verify that primers published in the study do in fact isolate exon 3 and 5 of the opsin gene for this primate.
Verify codons associated with functional sites in Table S1 of Corso et al
Verify how ‘inferred alleles’ in Corso et al were determined, using information from Bunce et al
Going through these verifications reinforces basic concepts and helps students understand the research basis of information provided in Evo-Ed materials, prior to conducting open-ended activities on color vision in primates.
Examples of open-ended activities:
Run BLAST using the forward primer site of exon 3 for the bald ukari to see what other primate species match that primer site, and determine from SNP analysis if these primates have the functional sites associated with dichromatic or trichromatic vision (e.g. the moustached tamarin).
Use multiple alignment and tree-building to determine relationships among primates, and relate to vision, behavior, and ecology.

39. Using Case It v6.07 to open NCBI blast site, to blast forward primer site for exon 3 (first menu option after highlighting primer site)

40. Results of BLAST analysis using forward primer site for exon 3.

41. Note that 543 nm for Saguinus is associated with the A-Y-A amino acids for sites 180, 277 and 285, respectively, and this can be verified as before by using search features of Case It v6.07.

42. Based on this analysis, does the Moustached Tamarin (Saguinus mystax) have dichromatic or trichromatic color vision? What information do you need to answer this question?

43. A Google search using “moustached tamarin color vision” revealed the following information from the Animal Diversity Web site at the University of Michigan:
“The development of trichromatic vision in primates has been proposed as an adaptation to allow better detection and identification of fruits in their forested habitats. New World monkeys, such as Saguinus, are unique in having a polymorphic vision system. Only heterozygous female mustached tamarins have trichromatic vision, with the rest retaining dichromatic vision. There is some evidence in the closely related species Saguinus labiatus that those with trichomatic vision "were more efficient at selecting ripe fruits than were dichromats" (Smith et al 2003, p.3159), but this has not been independently demonstrated in S. mystax. (Smith, et al., 2003a)”
“According to a study by Smith et al. (2003b), mixed-species troops of mustached and saddle-back tamarins were usually led by a mustached tamarin during migration through its home range. Color vision status did not consistently influence the choice of the lead animal of a troop. However, it was observed that a trichromatic female was significantly more likely to lead when the troop was approaching a fruiting tree. This lends support to the hypothesis that trichromats are more endowed to differentiate between fruiting and non-fruiting trees, and thus would be able to identify fruiting trees that are ready for feeding. Color vision is likely to be just one of many factors affecting leadership selection in wild S. mystax and S. fuscicollis troops. (Smith, et al., 2003b)”

44. Examples of directed activities:
Problem space: DNA samples used in the study, a table giving SNPs for different locations on exons of the opsin gene, primers used to isolate exons 3 and 5, and research studies related to color vision in primates.
Examples of directed activities:
Verify that primers published in the study do in fact isolate exon 3 and 5 of the opsin gene for this primate.
Verify codons associated with functional sites in Table S1 of Corso et al
Verify how ‘inferred alleles’ in Corso et al were determined, using information from Bunce et al
Going through these verifications reinforces basic concepts and helps students understand the research basis of information provided in Evo-Ed materials, prior to conducting open-ended activities on color vision in primates.
Examples of open-ended activities:
Run BLAST using the forward primer site of exon 3 for the bald ukari to see what other primate species match that primer site, and determine from SNP analysis if these primates have the functional sites associated with dichromatic or trichromatic vision (e.g. the moustached tamarin).
Use multiple alignment and tree-building to determine relationships among primates, and relate to vision, behavior, and ecology.

45. Phylogenetic tree for primate opsin exon 3

46. Session overview
Introduction to the Case It! project and ScienceCaseNet
Examples of undergraduate research applications
HHMI SEA-PHAGES
Color vision in primates (integration with EVO-ED)
Honey bee bioinformatics
Discussion of potential use in BioQUEST projects
Case It! Mobile as an alternative to the Case It! simulation

47. Case scenario - bioinformatics
Recent declines in honey bee populations have given rise to the syndrome named Colony Collapse Disorder (CCD). Several potential stressors have been identified. A team of research scientists, funded by the North American Honey Bee Council, decide to survey colonies from around North America for two of the notable stressors – Deformed Wing Virus (DWV), a virus that causes wing deformation, and Varroa destructor, a parasitic mite that feeds on the bee.
It has recently been reported that V. destructor transmits certain strains of DWV more effectively, and that long-term mite infection reduces virus diversity and leads to the prevalence of more pathogenic viruses (Martin et al. 2012). The scientists are interested in testing the relationship between DWV strains and the Varroa mite in North America.

48. Case scenario - bioinformatics
Bees tested from:
Central Ontario - low mite levels
Northwestern Washington - low mite levels
Southeast Florida - high mite levels
Oahu, Hawaii - high mite levels
Northern Arizona - moderate mite levels
Southern British Columbia - moderate mite levels

49. DNA sequence analysis using MEGA

50. DNA sequence analysis using MABL site

51. DNA sequence analysis using MAFFT site

52. Session overview
Introduction to the Case It! project and ScienceCaseNet
Examples of undergraduate research applications
HHMI SEA-PHAGES
Color vision in primates (integration with EVO-ED)
Honey bee bioinformatics
Discussion of potential use in BioQUEST projects
Case It! Mobile as an alternative to the Case It! simulation

53. Session overview
Introduction to the Case It! project and ScienceCaseNet
Examples of undergraduate research applications
HHMI SEA-PHAGES
Color vision in primates (integration with EVO-ED)
Honey bee bioinformatics
Discussion of potential use in BioQUEST projects
Case It! Mobile as an alternative to the Case It! simulation

54. Case It Mobile
Case It v6.06 is a PC application that can also be run on Macs running Windows, via Parallels or Bootcamp
Case It Mobile is a collection of screen-capture videos of the Case It simulation in action, that can be run using a web browser on a laptop, smart phone, or tablet
Useful when either time is not available to run the actual simulation, or PCs (or Macs running Windows) are not available
Examples: