1. Hidden in Plain Sight: Analysis of Biodiversity
NATIONAL CENTER FOR CASE STUDY TEACHING IN SCIENCE
Hidden in Plain Sight: Analysis of Biodiversity by
Kristen H. Short
Department of Biology and Environmental Science
Manchester University, Indiana
Licensed photo © Aleksandar Mijatovic | Dreamstime.com, ID

2. Learning Outcomes:
Define biodiversity and discuss its importance in ecosystems.
Explain several species concepts, and analyze the difficulties with identifying species. 
Discuss factors involved in the evolution of DNA sequences and the choice of a gene for a barcoding study, and interpret a gene tree to make inferences about sequence evolution in that gene. 
Define barcode gap and discuss the utility of DNA barcoding for species discovery and identification.
Discuss various ways that biodiversity is valued, and use this concept to evaluate the significance of cryptic biodiversity. 

3. John and Marie are biology students who are traveling to the Area de Conservación Guanacaste in Costa Rica on a spring break trip to conduct a biodiversity survey with their Principles of Biology class.
Photos from Wikimedia commons
Star represents

4. CQ1: Which measure would be a good way for John and Marie to assess biodiversity in Costa Rica?
Count the number of species
Count the number of different ecosystems there
Analyze genetic diversity within a few species
All of the above

5. Species richness: one aspect of biodiversity
The number of species total, or in a particular group
For discussion within your group:
Brainstorm all the ways you can think of that John and Marie might be able to count all the species of insects in the rainforest.
What are some difficulties you could anticipate as John and Marie attempt to count all the insect species?
1 minute
End

6. They decide to study species richness of butterflies, and they find many different types, including the neotropical skipper butterfly (Astraptes fulgerator).
Described in 1775
Ranges from southern U.S. to northern Argentina
Near desert to deep rain forest
Lowlands to middle elevations
Urban to pristine habitats
Large variety of plant food sources
Let’s take a look at some larvae…

7. CQ2: Are these two caterpillars the same species?
Yes No
We need more information

8. CQ3: Which species concept would you be using if you were attempting to classify these two caterpillars according to the information given here (their appearance)?
Biological species concept
Morphological species concept
Phylogenetic and evolutionary species concepts
Any of the above

9. Discuss in your groups: What additional information would help you decide if these two caterpillars belong to the same species?
1 minute
End

10. TRIGO eats plants of the Trigonia genus
You were looking at these 2 before!
10 different caterpillars within A. fulgerator complex, labeled with preferred food source; for example:
TRIGO eats plants of the Trigonia genus
CELT eats Celtis iguanaea
Adults all look much more similar
Picture of trigonia from
Picture of celtis iguanaea from
Fig. 2. Last-instar caterpillars of 10 species in the A. fulgerator complex from the ACG. Interim names reflect the primary larval food plant and, in some cases, a color character of the adult. (Hebert et al. 2004)

11. Discuss in your groups: Could it be scientifically reasonable to classify these 10 caterpillars as one species, if their adult butterflies all look virtually indistinguishable?
1 minute
End
Fig. 2. Last-instar caterpillars of 10 species in the A. fulgerator complex from the ACG. Interim names reflect the primary larval food plant and, in some cases, a color character of the adult. (Hebert et al. 2004)

12. CQ4: John and Marie do a DNA barcoding study of the caterpillars they have collected. They use the mitochondrial gene cytochrome c oxidase I (COI). For this gene, butterflies in the same genus (but different species) have average sequence divergence of 6.5%, while butterflies within the same species have average sequence divergence of only 0.25%. If two organisms have COI sequence divergence of 6.2%, what is the most likely conclusion?
They belong to the same species.
They belong to different species within the same genus.
They belong to different genera (genus, plural).
It cannot be determined with this information.

13. The “barcode gap:” small differences among individuals of the same species, larger differences among different species
Individual 1
Individual 2
Species 1
Individual 3
0-1%
Individual 4
Individual 5
Genus 1
about 2-7%
Individual 6
Species 2
Individual 7
0-1%
Individual 8

14. Barcoding genes:
Chosen because they have very little difference in sequences within species, but high enough between species to generate a barcode gap
Differ depending on taxonomic group:
Fish and invertebrates: COI (mitochondrial gene cytochrome c oxidase I)
Plants: rbcL (a chloroplast gene)
Fungi: ITS (internal transcribed spacer region)

15. CQ5: What is probably true about the COI gene used for barcoding, given what you know about sequence evolution?
Substantial mutations to the gene probably have no consequence to survival of the organism, and thus very frequently persist in the lineage.
Substantial mutations to the gene probably have negative consequences to survival of the organism, and thus persist only infrequently in the lineage.
This gene never mutates, so all versions of this gene among organisms are identical.
We could not make an inference about evolution of the COI gene.

16. CQ6: If a gene with a more rapid rate of evolution was used for barcoding, rather than COI, what could be the result?
There might not be enough differences among species to build a gene tree.
There might be too many differences, even within species, to build a gene tree.
The gene tree would be the same, regardless of which gene was used to make it.
There’s no way to predict with this information what the result would be.

17. CQ7: Which of the following could be a gene tree for these 4 individuals who represent typical barcodes for their species, based on partial sequences for their COI genes? Individual 1: ….AGTCGTCGTGAGATCGTCGTGA.... Individual 2: ….AGTCGTCGTGAAATCGTCGTGA Individual 3: ….AGTCGTCGTGAAATCTTCGGGA Individual 4: ….AGTCGTCGTGAAATCTTCGCGA.... 1 1 2 1 2 2 3 3 3 4 4 4 A B C

18. In your groups: Propose a mechanism by which the sequences could have evolved in this scenario, explaining at which point a nucleotide mutation occurred in the gene evolution.
Species 1: ….AGTCGTCGTGAGATCGTCGTGA.... Species 2: ….AGTCGTCGTGAAATCGTCGTGA.... Species 3: ….AGTCGTCGTGAAATCTTCGGGA.... Species 4: ….AGTCGTCGTGAAATCTTCGCGA....
1 minute 1 2 3
End 4

19. Sample sizes in parentheses
>10 identical sequences in black
Blue box will appear on click; say “on the next slide we’ll take a closer look at the part in the blue box here”
Caricatures of caterpillar color patterns
Fig. 3 (from Hebert et al. 2004). Tree showing distances for COI DNA sequences for individuals from the A. fulgerator complex.

20. TRIGO diverges from others in the complex by 5.4%
CELT diverges from others in the complex by 3.4%
Fig. 3 (partial, from Hebert et al. 2004). Tree showing distances for COI DNA sequences for individuals from the A. fulgerator complex.

21. CQ8: After their investigation, John and Marie can consider these to be two different species because
TRIGO
CELT
They look different
Their DNA barcodes are too different to consider them the same species
They eat different foods
All of the above

22. CQ9: In order to consider all the caterpillar types in this complex to be a single species, what level of DNA barcode divergence would we have to find among them? 0%
0-1%
1-3%
>4%

23. John and Marie found several different groups of COI barcodes for their A. fulgerator caterpillars.
Groundbreaking 2004 study that revealed “cryptic” (hidden) biodiversity (Hebert et al. 2004):
Cryptic species are 2 or more distinct but morphologically similar species that were previously classified as a single species.
Hypothesis was challenged by Brower (2006), who suggested we need more information but there are 3-7 species in the complex.
Other studies have revealed previously unknown biodiversity and are working to reveal more, for example:
Scorched mussel complex contains 4 cryptic species (Lee & Foighil 2004).
At least 3 cryptic species of snapping shrimp (Mathews 2006).
Numerous examples from many taxa.

24. CQ 10: Cryptic species are an example of species that are hard to identify using the morphological species concept. Which species concept would utilize gene trees constructed from DNA barcodes to identify species boundaries?
Biological species concept
Morphological species concept
Phylogenetic and evolutionary species concepts
Any of the above

25. CQ 11: When cryptic species are discovered, our understanding of which aspect of biodiversity has increased?
Species diversity/richness
Ecological diversity
Genetic diversity
Morphological diversity

26. CQ12: What proportion of Earth’s total biodiversity do you think we have already identified?
0-5%
5-25%
26-50%
51-90%
90-100%

27. Does cryptic biodiversity such as that discovered in A
Does cryptic biodiversity such as that discovered in A. fulgerator matter?
Imagine that your group is a research team that has presented a proposal to a scientific funding agency. Your group is requesting $1,000,000 to conduct a DNA barcoding expedition that could potentially uncover more cryptic biodiversity. Your proposal made it through the first round of reviews, but some reviewers commented that your rationale for why cryptic biodiversity is important needs more support. Specifically, they cite this butterfly example, noting that in this case, the additional species that were discovered are still quite morphologically and ecologically similar to each other, so an argument could be made that this sort of biodiversity is not significant to our understanding of how ecosystems and life on Earth function. What points can you make to counter this reasoning, and strengthen your argument that cryptic biodiversity is important and you should get funding to find it? ***You may wish to consider the video you watched before class regarding the value of nature/biodiversity to help you formulate your argument.***
4 minutes
End

28. DNA barcodes can be used in several ways:
Species discovery:
To reveal cryptic biodiversity, as in the case of A. fulgerator.
To reveal previously undescribed species through large scale sampling efforts.
Efforts by Barcode of Life are establishing barcode libraries and documenting new species through global sampling efforts (
2) Species identification: To identify an unknown individual to species level, if a barcode for that species has been documented
Identifying unknown foods, such as fish in restaurants (Willette et al. 2017).

29. CQ13: To use barcodes to identify individuals to the species level, what must be true?
There must be 0% sequence divergence between that individual and the species to which it is assigned.
There must be 0-1% sequence divergence between that individual and the species to which it is assigned.
There must be 5-7% sequence divergence between that individual and the species to which it is assigned.
There must be 100% sequence divergence between that individual and the species to which it is assigned.

30. CQ14: An individual with barcode sequence … AGTCGTCGTGAAATCTTCGGGT
CQ14: An individual with barcode sequence … AGTCGTCGTGAAATCTTCGGGT... is analyzed. To which species does it likely belong? Individual from species 1: ….AGTCGTCGTGAGATCGTCGTGA.... Individual from species 2: ….AGTCGTCGTGAAATCGTCGTGA Individual from species 3: ….AGTCGTCGTGAAATCTTCGGGA Individual from species 4: ….AGTCGTCGTGAAATCTTCGCGA.... 1 2 3 4
Cannot be determined

31. One-minute paper:
In 1-3 sentences, summarize and evaluate the way that DNA barcodes have changed the way biologists view and analyze biodiversity.
1 minute
End

32. References:
Brower, A.V.Z Problems with DNA barcodes for species delimitation: “Ten species” of Astraptes fulgerator reassessed (Lepidoptera: Hesperiidae). Systematics and Biodiversity 4(2): 127–132. Hebert, P.D., E.H. Penton, J.M. Burns, D.H. Janzen, and W. Hallwachs Ten species in one: DNA barcoding reveals cryptic species in the Neotropical skipper butterfly Astraptes fulgerator. PNAS 101(41): 14812– Lee, T., and D.O. Foigil Hidden Floridian biodiversity: mitochondrial and nuclear gene trees reveal four cryptic species within the scorches mussel, Brachidontes exustus , species complex. Molecular Ecology 13(11): 3527–3542. Mathews, L.M Cryptic biodiversity and phylogeographical patterns in a snapping shrimp species complex. Molecular Ecology 15(13): 4049–4063. Willette, D.A, S.E. Simmonds, S.H. Cheng, S. Esteves, T.L. Kane, H. Nuetzel, N. Pilaud, R. Rachmawati, and P.H. Barber Using DNA barcoding to track seafood mislabeling in Los Angeles restaurants. Conservation Biology, doi: /cobi
Anyone may, without requesting permission, use original figures or tables published in PNAS for noncommercial and educational use (i.e., in a review article, in a book that is not for sale), provided that the full journal reference is cited and, for articles published in volumes 90–105 (1993–2008), "Copyright (copyright year) National Academy of Sciences." Commercial reuse of figures and tables (i.e., in promotional materials, in a textbook for sale) requires permission from PNAS.