1. Introduction to Python
BCHB524 Lecture 4
BCHB524 - Edwards

2. Outline Homework #1 Solutions Review Control flow: if statement
Control flow: for statement
Exercises
BCHB524 - Edwards

3. Review Printing and execution Variables and basic data-types:
integers, floats, strings
Arithmetic with, conversion between
String characters and chunks, string methods
Functions, using/calling and defining:
Use in any expression
Parameters as input, return for output
Functions calling other functions (oh my!)
If statements – conditional execution
BCHB524 - Edwards

4. Control Flow: if statement
Execution path depends on string in seq.
Make sure you change seq to different values.
# The input DNA sequence
seq = 'atggcatgacgttattacgactctgtgtggcgtctgctggg'
# Remove the initial Met codon if it is there
if seq.startswith('atg'):
print "Sequence without initial Met:",seq[3:]
else:
print "Sequence (no initial Met):",seq
BCHB524 - Edwards

5. Control Flow: if statement
# The input DNA sequence
seq = 'atggcatgacgttattacgactctgtgtggcgtctgctggg'
# Remove the initial Met codon if it is there
if seq.startswith('atg'):
initMet = True
newseq = seq[3:]
else:
initMet = False
newseq = seq
# Output the results
print "Original sequence:",seq
print "Sequence starts with Met:",initMet
print "Sequence without initial Met:",newseq
BCHB524 - Edwards

6. Control Flow: if statement
# The input DNA sequence
seq = 'atggcatgacgttattacgactctgtgtggcgtctgctggg'
# Remove the initial Met codon if it is there
initMet = seq.startswith('atg'):
if initMet:
newseq = seq[3:]
else:
newseq = seq
# Output the results
print "Original sequence:",seq
print "Sequence starts with Met:",initMet
print "Sequence without initial Met:",newseq
BCHB524 - Edwards

7. Control Flow: if statement
# The input DNA sequence
seq = 'atggcatgacgttattacgactctgtgtggcgtctgctggg'
# Remove the initial Met codon if it is there
initMet = seq.startswith('atg')
if initMet:
seq = seq[3:]
# Output the results
print "Sequence starts with Met:",initMet
print "Sequence without initial Met:",seq
BCHB524 - Edwards

8. Serial if statement # Determine the complementary nucleotide
def complement(nuc):
if nuc == 'A':
comp = 'T'
if nuc == 'T':
comp = 'A'
if nuc == 'C':
comp = 'G'
if nuc == 'G':
comp = 'C'
return comp
# Use the complement function
print "The complement of A is",complement('A')
print "The complement of T is",complement('T')
print "The complement of C is",complement('C')
print "The complement of G is",complement('G')
BCHB524 - Edwards

9. Compound if statement
# Determine the complementary nucleotide def complement(nuc):     if nuc == 'A':         comp = 'T'     elif nuc == 'T':         comp = 'A'     elif nuc == 'C':         comp = 'G'     elif nuc == 'G':         comp = 'C'     else:         comp = nuc     return comp # Use the complement function print "The complement of A is",complement('A') print "The complement of T is",complement('T') print "The complement of C is",complement('C') print "The complement of G is",complement('G')
BCHB524 - Edwards

10. If statement conditions
Any expression (variable, arithmetic, function call, etc.) that evaluates to True or False
Any expression tested against another expression using:
== (equality), != (inequality)
< (less than), <= (less than or equal)
> (greater than), >= (greater than or equal)
in (an element of)
Conditions can be combined using:
and, or, not, and parentheses
BCHB524 - Edwards

11. For (each) statements Sequential/Iterative execution
Note use of indentation to define a block!
# Print the numbers 0 through 4
for i in range(0,5):
print i
# Print the nucleotides in seq
seq = 'ATGGCAT'
for nuc in seq:
print nuc
BCHB524 - Edwards

12. For (each) statements # Input to program
seq = 'AGTAGTTCGCGTAGCTAGCTAGCTATGCG'
# Examine each symbol in seq and count the A's
count = 0
for nuc in seq:
if nuc == 'A':
count = count + 1
# Output the result
print "Sequence",seq,"contains",count,"A symbols"
BCHB524 - Edwards

13. For (each) statements # Examine each symbol in seq and count the A's
def countAs(seq):
count = 0
for nuc in seq:
if nuc == 'A':
count = count + 1
return count
# Input to program
inseq = 'AGTAGTTCGCGTAGCTAGCTAGCTATGCG'
# Compute count
aCount = countAs(inseq)
# Output the result
print "Sequence",inseq,"contains",aCount,"A symbols"
BCHB524 - Edwards

14. For (each) statements
# Examine each symbol in seq and count those that match sym
def countSym(seq,sym):
count = 0
for nuc in seq:
if nuc == sym:
count = count + 1
return count
# Input to program
inseq = 'AGTAGTTCGCGTAGCTAGCTAGCTATGCG'
# Compute count
aCount = countSym(inseq,'A')
# Output the result
print "Sequence",inseq,"contains",aCount,"A symbols"
BCHB524 - Edwards

15. Exercise 1
Write a Python program to compute the reverse complement of a codon
Use my solution to Homework #1 Exercise #1 as a starting point
Add the “complement” function of this lecture (slide 9) as provided.
Modularize! Place the reverse complement code in a new function.
Call the new function with a variety of codons
Change the complement function to handle upper and lower-case nucleotide symbols.
Test your code with upper and lower-case codons.
BCHB524 - Edwards

16. Exercise 2
Write a Python program to determine whether or not a DNA sequence consists of a (integer) number of (perfect) "tandem" repeats.
Test it on sequences:
AAAAAAAAAAAAAAAA
CACACACACACACAC
ATTCGATTCGATTCG
GTAGTAGTAGTAGTA
TCAGTCACTCACTCAG
Hint: Is the sequence the same as many repetitions of its first character?
Hint: Is the first half of the sequence the same as the second half of the sequence?
BCHB524 - Edwards

17. Homework 2 Due Monday, September 18th.
Use only the techniques introduced so far.
Make sure you can run the programs demonstrated in lecture.
Submit Exercise 3.1, 4.1, 4.2 solutions to Canvas.
BCHB524 - Edwards