1. Chapter 12
DNA Technology

2. Stem Cells

3. Adult stem Blood cells cells in bone marrow Nerve cells Cultured
embryonic
stem cells
Figure Differentiation of embryonic stem cells in culture
Heart muscle cells
Different culture
conditions
Different types of
differentiated cells
Figure 11.15

4. Umbilical Cord Blood Banking
Can be collected at birth
Contains partially differentiated stem cells
Limited use
Student Misconceptions and Concerns
1. Students often fail to see the similarities between identical twins and cloning. Each process produces multiple individuals with identical nuclear genetic material.
2. Students often assume that clones will appear and act identically. This misunderstanding provides an opportunity to discuss the important influence of the environment in shaping the final phenotype.
3. Students might not immediately understand why reproductive cloning is necessary to transmit specific traits in farm animals. They may fail to realize that unlike cloning, sexual reproduction mixes the genetic material and may not produce offspring with the desired trait(s).
Teaching Tips
1. The researchers that cloned Dolly the sheep from a mammary gland cell named Dolly after the celebrity Dolly Parton.
2. An even more remarkable aspect of salamander limb regeneration is that only the missing limb segments are regenerated. If an arm is amputated at the elbow, only the forearm, wrist, and hand are regenerated. Somehow, the cells can detect what is missing and replace only those parts!
3. Preimplantation genetic diagnosis (PGD) is a genetic screening technique that removes one or two cells from an embryo at about the 6–10 cell stage. The cells that are removed are genetically analyzed while the remaining embryonic cell mass retains the potential to develop into a normal individual. This technique permits embryos to be genetically screened before implanting them into a woman. However, PGD has another potential use. Researchers can use PGD to obtain embryonic stem cells without destroying a human embryo. This procedure might be more acceptable than methods that destroy the embryo to obtain embryonic stem cells.
4. The transplantation of pig or other nonhuman tissues into humans (called xenotransplantation) risks the introduction of pig (or other animal) viruses into humans. This viral DNA might not otherwise have the capacity for transmission to humans.
5. Political restrictions on the use of federal funds to study stem cells from various sources, illustrates the influence of society on the directions of science. As time permits, consider opportunities to discuss or investigate this and other ways that science and society interact.

5. Figure 12.1 Glowing fish
Figure 12.1

6. Recombinant DNA Techniques
Bacteria are the workhorses of modern biotechnology.
In the lab, biologists use bacterial plasmids (small, circular DNA molecules) that are separate from the much larger bacterial chromosome.
Can easily pick up foreign DNA
Are taken up by bacterial cells; called transformation
Act as vectors (DNA carriers that move genes from one cell to another)
Recombinant DNA help biologists produce large quantities of a desired protein.
Student Misconceptions and Concerns
1. The roles of restriction enzymes and nucleic acid probes, as well as many other aspects of recombinant DNA techniques, rely upon a firm and comfortable understanding of basic molecular genetics. Consider addressing Chapter 12 after an exam that addresses the content in Chapters 10 and 11.
2. Students might bring some awareness and/or concerns about biotechnology to the classroom, for example, controversies regarding genetically modified (GM) foods. This experience can be used to generate class interest and to highlight the importance of good information when making judgments. Consider starting class with a headline addressing one of these issues.
Teaching Tips
1. Annual flu vaccinations are a common example of using vaccines to prevent diseases that cannot be easily cured. However, students might not understand why many people receive the vaccine every year. A new annual vaccine is necessary because the flu viruses keep evolving.
2. Genetically engineered organisms are controversial, creating various degrees and directions of social resistance. Yet, many debates around issues of science are confused by misinformation. This may be an opportunity for you to make an extra credit or regular assignment for students to take a position, one side or the other, on some aspect of this or related issues. The science would need to be accurate. Students might debate whether a food product made from GM/transgenic organisms should be labeled as such, or students can discuss the risks or advantages of producing GM organisms.
3. The origin of the name “restriction enzymes” may be of interest. In nature, these enzymes protect bacterial cells against foreign DNA. Thus, these enzymes “restrict” the invasion of foreign genetic material.
4. The ability to swap genes between prokaryotes and eukaryotes using the technologies described in this chapter reveal the fundamental genetic mechanisms shared by all forms of life. This very strong evidence of common descent is a lesson about evolution that may be missed by your students.
5. Students might think you are just making a bad joke by noting that laboratory-synthesized genes are “designer genes,” but this is a common term. Search the Internet using the keywords “designer genes,” and many scientific (and unscientific) sites will be found.
6. A genomic library of the sentence you are now reading would be all of the sentence fragments that make up the sentence. One could string together all of the words of this first sentence, without spaces between letters, and then conduct a word-processing edit placing a space between any place where an “e” is followed by the letter “n” The resulting fragments of this original sentence would look like this, and would be like a type of “genomic library.”
Age nomiclibraryofthese nte nceyouare nowreadingwouldbeallofthese nte ncefragme ntsthatmadeupthese nte nce.
7. Some Internet search programs rely upon a methodology similar in one way to the use of a nucleic acid probe. For example, if you want to find the lyrics to a particular song, but you do not know the song title or artist, you might search the Internet using a unique phrase from the song. (For example, search using “yellow submarine”.) The search engine will scan millions of web pages to identify those sites containing that particular phrase. However, unlike a nucleic acid probe, you would search for the song by using a few of the lyrics. A nucleic acid probe would search using a sequence complementary to the desired sequence.
8. Roundup Ready Corn, a product of Monsanto, is resistant to the herbicide Roundup. The general strategy for farmers is to spray fields of Roundup Ready corn with the herbicide Roundup, killing weeds but not the corn. A search of the Internet will quickly reveal the controversy associated with this and other genetically modified organisms (GMO), which can encourage interesting discussions and promote critical thinking skills.
9. As gene therapy technology expands, our ability to modify the genome in human embryos, created through in vitro fertilization, permits genetic modification at the earliest stages of life. Future generations of humans, like our crops today, may include those with and without a genetically modified ancestry. The benefits and challenges of these technologies raise issues many students have never considered. Our students, and the generations soon to follow, will face the potential of directed human evolution.

7. Plasmids Bacterial chromosome Remnant of bacterium Figure 12.7
Figure 12.7 Bacterial plasmids
Bacterial
chromosome
Remnant of
bacterium
Colorized TEM
Figure 12.7

8. Cut both DNAs
with same
enzyme.
DNA fragments
from cell
Isolate
DNA.
Gene of
interest
Other
genes
Mix the DNAs and
join them together.
Gene of interest
Isolate
plasmids.
Cell containing
the gene of interest
Bacterial cell
Recombinant DNA plasmids
Bacteria take up recombinant plasmids.
Plasmid
DNA
Bacterial clone
Recombinant bacteria
Clone the bacteria.
Figure 12.8 Using recombinant DNA technology to produce useful products (Step 8)
Find the clone with
the gene of interest.
Some uses
of genes
Some uses
of proteins
Gene for pest
resistance
Protein for
dissolving
clots
Protein for
“stone-washing”
jeans
Gene for
toxic-cleanup
bacteria
The gene and protein
of interest are isolated
from the bacteria.
Genes may be
inserted into
other organisms.
Harvested
proteins may be
used directly.
Figure

9. A Closer Look: Cutting and Pasting DNA with Restriction Enzymes
Recombinant DNA is produced by combining two ingredients:
A bacterial plasmid
The gene of interest
To combine these ingredients, a piece of DNA must be spliced into a plasmid.
This splicing process can be accomplished by:
Using restriction enzymes, which cut DNA at specific nucleotide sequences
Student Misconceptions and Concerns
1. The roles of restriction enzymes and nucleic acid probes, as well as many other aspects of recombinant DNA techniques, rely upon a firm and comfortable understanding of basic molecular genetics. Consider addressing Chapter 12 after an exam that addresses the content in Chapters 10 and 11.
2. Students might bring some awareness and/or concerns about biotechnology to the classroom, for example, controversies regarding genetically modified (GM) foods. This experience can be used to generate class interest and to highlight the importance of good information when making judgments. Consider starting class with a headline addressing one of these issues.
Teaching Tips
1. Annual flu vaccinations are a common example of using vaccines to prevent diseases that cannot be easily cured. However, students might not understand why many people receive the vaccine every year. A new annual vaccine is necessary because the flu viruses keep evolving.
2. Genetically engineered organisms are controversial, creating various degrees and directions of social resistance. Yet, many debates around issues of science are confused by misinformation. This may be an opportunity for you to make an extra credit or regular assignment for students to take a position, one side or the other, on some aspect of this or related issues. The science would need to be accurate. Students might debate whether a food product made from GM/transgenic organisms should be labeled as such, or students can discuss the risks or advantages of producing GM organisms.
3. The origin of the name “restriction enzymes” may be of interest. In nature, these enzymes protect bacterial cells against foreign DNA. Thus, these enzymes “restrict” the invasion of foreign genetic material.
4. The ability to swap genes between prokaryotes and eukaryotes using the technologies described in this chapter reveal the fundamental genetic mechanisms shared by all forms of life. This very strong evidence of common descent is a lesson about evolution that may be missed by your students.
5. Students might think you are just making a bad joke by noting that laboratory-synthesized genes are “designer genes,” but this is a common term. Search the Internet using the keywords “designer genes,” and many scientific (and unscientific) sites will be found.
6. A genomic library of the sentence you are now reading would be all of the sentence fragments that make up the sentence. One could string together all of the words of this first sentence, without spaces between letters, and then conduct a word-processing edit placing a space between any place where an “e” is followed by the letter “n” The resulting fragments of this original sentence would look like this, and would be like a type of “genomic library.”
Age nomiclibraryofthese nte nceyouare nowreadingwouldbeallofthese nte ncefragme ntsthatmadeupthese nte nce.
7. Some Internet search programs rely upon a methodology similar in one way to the use of a nucleic acid probe. For example, if you want to find the lyrics to a particular song, but you do not know the song title or artist, you might search the Internet using a unique phrase from the song. (For example, search using “yellow submarine”.) The search engine will scan millions of web pages to identify those sites containing that particular phrase. However, unlike a nucleic acid probe, you would search for the song by using a few of the lyrics. A nucleic acid probe would search using a sequence complementary to the desired sequence.
8. Roundup Ready Corn, a product of Monsanto, is resistant to the herbicide Roundup. The general strategy for farmers is to spray fields of Roundup Ready corn with the herbicide Roundup, killing weeds but not the corn. A search of the Internet will quickly reveal the controversy associated with this and other genetically modified organisms (GMO), which can encourage interesting discussions and promote critical thinking skills.
9. As gene therapy technology expands, our ability to modify the genome in human embryos, created through in vitro fertilization, permits genetic modification at the earliest stages of life. Future generations of humans, like our crops today, may include those with and without a genetically modified ancestry. The benefits and challenges of these technologies raise issues many students have never considered. Our students, and the generations soon to follow, will face the potential of directed human evolution.
© 2010 Pearson Education, Inc.

10. Restriction enzymes
Bacterial enzymes that recognize and cut DNA at specific sequences
What is there use naturally in bacteria?
Are very specific
Usually recognize sequences 4-8 nucleotides long
Sequences recognized are palindromes
Example: EcoR1 recognizes GAATTC and cuts always between the G and A

11. Producing pieces of DNA called restriction fragments with “sticky ends” important for joining DNA from different sources
DNA ligase connects the DNA pieces into continuous strands by forming bonds between adjacent nucleotides.
Student Misconceptions and Concerns
1. The roles of restriction enzymes and nucleic acid probes, as well as many other aspects of recombinant DNA techniques, rely upon a firm and comfortable understanding of basic molecular genetics. Consider addressing Chapter 12 after an exam that addresses the content in Chapters 10 and 11.
2. Students might bring some awareness and/or concerns about biotechnology to the classroom, for example, controversies regarding genetically modified (GM) foods. This experience can be used to generate class interest and to highlight the importance of good information when making judgments. Consider starting class with a headline addressing one of these issues.
Teaching Tips
1. Annual flu vaccinations are a common example of using vaccines to prevent diseases that cannot be easily cured. However, students might not understand why many people receive the vaccine every year. A new annual vaccine is necessary because the flu viruses keep evolving.
2. Genetically engineered organisms are controversial, creating various degrees and directions of social resistance. Yet, many debates around issues of science are confused by misinformation. This may be an opportunity for you to make an extra credit or regular assignment for students to take a position, one side or the other, on some aspect of this or related issues. The science would need to be accurate. Students might debate whether a food product made from GM/transgenic organisms should be labeled as such, or students can discuss the risks or advantages of producing GM organisms.
3. The origin of the name “restriction enzymes” may be of interest. In nature, these enzymes protect bacterial cells against foreign DNA. Thus, these enzymes “restrict” the invasion of foreign genetic material.
4. The ability to swap genes between prokaryotes and eukaryotes using the technologies described in this chapter reveal the fundamental genetic mechanisms shared by all forms of life. This very strong evidence of common descent is a lesson about evolution that may be missed by your students.
5. Students might think you are just making a bad joke by noting that laboratory-synthesized genes are “designer genes,” but this is a common term. Search the Internet using the keywords “designer genes,” and many scientific (and unscientific) sites will be found.
6. A genomic library of the sentence you are now reading would be all of the sentence fragments that make up the sentence. One could string together all of the words of this first sentence, without spaces between letters, and then conduct a word-processing edit placing a space between any place where an “e” is followed by the letter “n” The resulting fragments of this original sentence would look like this, and would be like a type of “genomic library.”
Age nomiclibraryofthese nte nceyouare nowreadingwouldbeallofthese nte ncefragme ntsthatmadeupthese nte nce.
7. Some Internet search programs rely upon a methodology similar in one way to the use of a nucleic acid probe. For example, if you want to find the lyrics to a particular song, but you do not know the song title or artist, you might search the Internet using a unique phrase from the song. (For example, search using “yellow submarine”.) The search engine will scan millions of web pages to identify those sites containing that particular phrase. However, unlike a nucleic acid probe, you would search for the song by using a few of the lyrics. A nucleic acid probe would search using a sequence complementary to the desired sequence.
8. Roundup Ready Corn, a product of Monsanto, is resistant to the herbicide Roundup. The general strategy for farmers is to spray fields of Roundup Ready corn with the herbicide Roundup, killing weeds but not the corn. A search of the Internet will quickly reveal the controversy associated with this and other genetically modified organisms (GMO), which can encourage interesting discussions and promote critical thinking skills.
9. As gene therapy technology expands, our ability to modify the genome in human embryos, created through in vitro fertilization, permits genetic modification at the earliest stages of life. Future generations of humans, like our crops today, may include those with and without a genetically modified ancestry. The benefits and challenges of these technologies raise issues many students have never considered. Our students, and the generations soon to follow, will face the potential of directed human evolution.

12. for a restriction enzyme
Recognition sequence
for a restriction enzyme
DNA
A restriction enzyme cuts
the DNA into fragments.
Restriction
enzyme
Sticky
end
Sticky
end
Figure 12.9 Cutting and pasting DNA (Step 1)
Figure

13. for a restriction enzyme
Recognition sequence
for a restriction enzyme
DNA
A restriction enzyme cuts
the DNA into fragments.
Restriction
enzyme
Sticky
end
Sticky
end
A DNA fragment is added
from another source.
Figure 12.9 Cutting and pasting DNA (Step 2)
Figure

14. for a restriction enzyme
Recognition sequence
for a restriction enzyme
DNA
A restriction enzyme cuts
the DNA into fragments.
Restriction
enzyme
Sticky
end
Sticky
end
A DNA fragment is added
from another source.
Fragments stick together by
base pairing.
Figure 12.9 Cutting and pasting DNA (Step 3)
Figure

15. for a restriction enzyme
Recognition sequence
for a restriction enzyme
DNA
A restriction enzyme cuts
the DNA into fragments.
Restriction
enzyme
Sticky
end
Sticky
end
A DNA fragment is added
from another source.
Fragments stick together by
base pairing.
Figure 12.9 Cutting and pasting DNA (Step 4)
DNA
ligase
DNA ligase joins the
fragments into strands.
Recombinant DNA molecule
Figure

16. Genetic engineering vocab
Recombinant DNA- nucleotide sequences from two different sources to form a single DNA molecule.
genetic engineering, the direct manipulation of DNA for practical purposes.
Biotechnology – use of organisms or their components to make useful products
Transgenic organism – contains a gene from another organism, typically a different species
Genetically modified organisms (GMOs)- organisms that have acquired one or more genes by artificial means.
Student Misconceptions and Concerns
1. The roles of restriction enzymes and nucleic acid probes, as well as many other aspects of recombinant DNA techniques, rely upon a firm and comfortable understanding of basic molecular genetics. Consider addressing Chapter 12 after an exam that addresses the content in Chapters 10 and 11.
2. Students might bring some awareness and/or concerns about biotechnology to the classroom, for example, controversies regarding genetically modified (GM) foods. This experience can be used to generate class interest and to highlight the importance of good information when making judgments. Consider starting class with a headline addressing one of these issues.
Teaching Tips
1. Annual flu vaccinations are a common example of using vaccines to prevent diseases that cannot be easily cured. However, students might not understand why many people receive the vaccine every year. A new annual vaccine is necessary because the flu viruses keep evolving.
2. Genetically engineered organisms are controversial, creating various degrees and directions of social resistance. Yet, many debates around issues of science are confused by misinformation. This may be an opportunity for you to make an extra credit or regular assignment for students to take a position, one side or the other, on some aspect of this or related issues. The science would need to be accurate. Students might debate whether a food product made from GM/transgenic organisms should be labeled as such, or students can discuss the risks or advantages of producing GM organisms.
3. The origin of the name “restriction enzymes” may be of interest. In nature, these enzymes protect bacterial cells against foreign DNA. Thus, these enzymes “restrict” the invasion of foreign genetic material.
4. The ability to swap genes between prokaryotes and eukaryotes using the technologies described in this chapter reveal the fundamental genetic mechanisms shared by all forms of life. This very strong evidence of common descent is a lesson about evolution that may be missed by your students.
5. Students might think you are just making a bad joke by noting that laboratory-synthesized genes are “designer genes,” but this is a common term. Search the Internet using the keywords “designer genes,” and many scientific (and unscientific) sites will be found.
6. A genomic library of the sentence you are now reading would be all of the sentence fragments that make up the sentence. One could string together all of the words of this first sentence, without spaces between letters, and then conduct a word-processing edit placing a space between any place where an “e” is followed by the letter “n” The resulting fragments of this original sentence would look like this, and would be like a type of “genomic library.”
Age nomiclibraryofthese nte nceyouare nowreadingwouldbeallofthese nte ncefragme ntsthatmadeupthese nte nce.
7. Some Internet search programs rely upon a methodology similar in one way to the use of a nucleic acid probe. For example, if you want to find the lyrics to a particular song, but you do not know the song title or artist, you might search the Internet using a unique phrase from the song. (For example, search using “yellow submarine”.) The search engine will scan millions of web pages to identify those sites containing that particular phrase. However, unlike a nucleic acid probe, you would search for the song by using a few of the lyrics. A nucleic acid probe would search using a sequence complementary to the desired sequence.
8. Roundup Ready Corn, a product of Monsanto, is resistant to the herbicide Roundup. The general strategy for farmers is to spray fields of Roundup Ready corn with the herbicide Roundup, killing weeds but not the corn. A search of the Internet will quickly reveal the controversy associated with this and other genetically modified organisms (GMO), which can encourage interesting discussions and promote critical thinking skills.
9. As gene therapy technology expands, our ability to modify the genome in human embryos, created through in vitro fertilization, permits genetic modification at the earliest stages of life. Future generations of humans, like our crops today, may include those with and without a genetically modified ancestry. The benefits and challenges of these technologies raise issues many students have never considered. Our students, and the generations soon to follow, will face the potential of directed human evolution.

17. Cut both DNAs
with same
enzyme.
DNA fragments
from cell
Isolate
DNA.
Gene of
interest
Other
genes
Mix the DNAs and
join them together.
Gene of interest
Isolate
plasmids.
Cell containing
the gene of interest
Bacterial cell
Recombinant DNA plasmids
Bacteria take up recombinant plasmids.
Plasmid
DNA
Bacterial clone
Recombinant bacteria
Clone the bacteria.
Figure 12.8 Using recombinant DNA technology to produce useful products (Step 8)
Find the clone with
the gene of interest.
Some uses
of genes
Some uses
of proteins
Gene for pest
resistance
Protein for
dissolving
clots
Protein for
“stone-washing”
jeans
Gene for
toxic-cleanup
bacteria
The gene and protein
of interest are isolated
from the bacteria.
Genes may be
inserted into
other organisms.
Harvested
proteins may be
used directly.
Figure

18. Warm up December 17
How do these cats show examples of genetic engineering, transgenic organisms and recombinant DNA?

19. marker gene Gene for human growth hormone DNA recombination Human Cell
Sticky ends
DNA recombination
DNA insertion
Bacterial Cell
Plasmid
Bacterial chromosome
Bacterial cell for containing gene for human growth hormone
marker gene

20. Making Humulin - 1st engineered product
Student Misconceptions and Concerns
1. The roles of restriction enzymes and nucleic acid probes, as well as many other aspects of recombinant DNA techniques, rely upon a firm and comfortable understanding of basic molecular genetics. Consider addressing Chapter 12 after an exam that addresses the content in Chapters 10 and 11.
2. Students might bring some awareness and/or concerns about biotechnology to the classroom, for example, controversies regarding genetically modified (GM) foods. This experience can be used to generate class interest and to highlight the importance of good information when making judgments. Consider starting class with a headline addressing one of these issues.
Teaching Tips
1. Annual flu vaccinations are a common example of using vaccines to prevent diseases that cannot be easily cured. However, students might not understand why many people receive the vaccine every year. A new annual vaccine is necessary because the flu viruses keep evolving.
2. Genetically engineered organisms are controversial, creating various degrees and directions of social resistance. Yet, many debates around issues of science are confused by misinformation. This may be an opportunity for you to make an extra credit or regular assignment for students to take a position, one side or the other, on some aspect of this or related issues. The science would need to be accurate. Students might debate whether a food product made from GM/transgenic organisms should be labeled as such, or students can discuss the risks or advantages of producing GM organisms.
3. The origin of the name “restriction enzymes” may be of interest. In nature, these enzymes protect bacterial cells against foreign DNA. Thus, these enzymes “restrict” the invasion of foreign genetic material.
4. The ability to swap genes between prokaryotes and eukaryotes using the technologies described in this chapter reveal the fundamental genetic mechanisms shared by all forms of life. This very strong evidence of common descent is a lesson about evolution that may be missed by your students.
5. Students might think you are just making a bad joke by noting that laboratory-synthesized genes are “designer genes,” but this is a common term. Search the Internet using the keywords “designer genes,” and many scientific (and unscientific) sites will be found.
6. A genomic library of the sentence you are now reading would be all of the sentence fragments that make up the sentence. One could string together all of the words of this first sentence, without spaces between letters, and then conduct a word-processing edit placing a space between any place where an “e” is followed by the letter “n” The resulting fragments of this original sentence would look like this, and would be like a type of “genomic library.”
Age nomiclibraryofthese nte nceyouare nowreadingwouldbeallofthese nte ncefragme ntsthatmadeupthese nte nce.
7. Some Internet search programs rely upon a methodology similar in one way to the use of a nucleic acid probe. For example, if you want to find the lyrics to a particular song, but you do not know the song title or artist, you might search the Internet using a unique phrase from the song. (For example, search using “yellow submarine”.) The search engine will scan millions of web pages to identify those sites containing that particular phrase. However, unlike a nucleic acid probe, you would search for the song by using a few of the lyrics. A nucleic acid probe would search using a sequence complementary to the desired sequence.
8. Roundup Ready Corn, a product of Monsanto, is resistant to the herbicide Roundup. The general strategy for farmers is to spray fields of Roundup Ready corn with the herbicide Roundup, killing weeds but not the corn. A search of the Internet will quickly reveal the controversy associated with this and other genetically modified organisms (GMO), which can encourage interesting discussions and promote critical thinking skills.
9. As gene therapy technology expands, our ability to modify the genome in human embryos, created through in vitro fertilization, permits genetic modification at the earliest stages of life. Future generations of humans, like our crops today, may include those with and without a genetically modified ancestry. The benefits and challenges of these technologies raise issues many students have never considered. Our students, and the generations soon to follow, will face the potential of directed human evolution.

21. Genetically Modified (GM) Foods
Student Misconceptions and Concerns
1. The roles of restriction enzymes and nucleic acid probes, as well as many other aspects of recombinant DNA techniques, rely upon a firm and comfortable understanding of basic molecular genetics. Consider addressing Chapter 12 after an exam that addresses the content in Chapters 10 and 11.
2. Students might bring some awareness and/or concerns about biotechnology to the classroom, for example, controversies regarding genetically modified (GM) foods. This experience can be used to generate class interest and to highlight the importance of good information when making judgments. Consider starting class with a headline addressing one of these issues.
Teaching Tips
1. Annual flu vaccinations are a common example of using vaccines to prevent diseases that cannot be easily cured. However, students might not understand why many people receive the vaccine every year. A new annual vaccine is necessary because the flu viruses keep evolving.
2. Genetically engineered organisms are controversial, creating various degrees and directions of social resistance. Yet, many debates around issues of science are confused by misinformation. This may be an opportunity for you to make an extra credit or regular assignment for students to take a position, one side or the other, on some aspect of this or related issues. The science would need to be accurate. Students might debate whether a food product made from GM/transgenic organisms should be labeled as such, or students can discuss the risks or advantages of producing GM organisms.
3. The origin of the name “restriction enzymes” may be of interest. In nature, these enzymes protect bacterial cells against foreign DNA. Thus, these enzymes “restrict” the invasion of foreign genetic material.
4. The ability to swap genes between prokaryotes and eukaryotes using the technologies described in this chapter reveal the fundamental genetic mechanisms shared by all forms of life. This very strong evidence of common descent is a lesson about evolution that may be missed by your students.
5. Students might think you are just making a bad joke by noting that laboratory-synthesized genes are “designer genes,” but this is a common term. Search the Internet using the keywords “designer genes,” and many scientific (and unscientific) sites will be found.
6. A genomic library of the sentence you are now reading would be all of the sentence fragments that make up the sentence. One could string together all of the words of this first sentence, without spaces between letters, and then conduct a word-processing edit placing a space between any place where an “e” is followed by the letter “n” The resulting fragments of this original sentence would look like this, and would be like a type of “genomic library.”
Age nomiclibraryofthese nte nceyouare nowreadingwouldbeallofthese nte ncefragme ntsthatmadeupthese nte nce.
7. Some Internet search programs rely upon a methodology similar in one way to the use of a nucleic acid probe. For example, if you want to find the lyrics to a particular song, but you do not know the song title or artist, you might search the Internet using a unique phrase from the song. (For example, search using “yellow submarine”.) The search engine will scan millions of web pages to identify those sites containing that particular phrase. However, unlike a nucleic acid probe, you would search for the song by using a few of the lyrics. A nucleic acid probe would search using a sequence complementary to the desired sequence.
8. Roundup Ready Corn, a product of Monsanto, is resistant to the herbicide Roundup. The general strategy for farmers is to spray fields of Roundup Ready corn with the herbicide Roundup, killing weeds but not the corn. A search of the Internet will quickly reveal the controversy associated with this and other genetically modified organisms (GMO), which can encourage interesting discussions and promote critical thinking skills.
9. As gene therapy technology expands, our ability to modify the genome in human embryos, created through in vitro fertilization, permits genetic modification at the earliest stages of life. Future generations of humans, like our crops today, may include those with and without a genetically modified ancestry. The benefits and challenges of these technologies raise issues many students have never considered. Our students, and the generations soon to follow, will face the potential of directed human evolution.

22. “Golden rice” Student Misconceptions and Concerns
1. The roles of restriction enzymes and nucleic acid probes, as well as many other aspects of recombinant DNA techniques, rely upon a firm and comfortable understanding of basic molecular genetics. Consider addressing Chapter 12 after an exam that addresses the content in Chapters 10 and 11.
2. Students might bring some awareness and/or concerns about biotechnology to the classroom, for example, controversies regarding genetically modified (GM) foods. This experience can be used to generate class interest and to highlight the importance of good information when making judgments. Consider starting class with a headline addressing one of these issues.
Teaching Tips
1. Annual flu vaccinations are a common example of using vaccines to prevent diseases that cannot be easily cured. However, students might not understand why many people receive the vaccine every year. A new annual vaccine is necessary because the flu viruses keep evolving.
2. Genetically engineered organisms are controversial, creating various degrees and directions of social resistance. Yet, many debates around issues of science are confused by misinformation. This may be an opportunity for you to make an extra credit or regular assignment for students to take a position, one side or the other, on some aspect of this or related issues. The science would need to be accurate. Students might debate whether a food product made from GM/transgenic organisms should be labeled as such, or students can discuss the risks or advantages of producing GM organisms.
3. The origin of the name “restriction enzymes” may be of interest. In nature, these enzymes protect bacterial cells against foreign DNA. Thus, these enzymes “restrict” the invasion of foreign genetic material.
4. The ability to swap genes between prokaryotes and eukaryotes using the technologies described in this chapter reveal the fundamental genetic mechanisms shared by all forms of life. This very strong evidence of common descent is a lesson about evolution that may be missed by your students.
5. Students might think you are just making a bad joke by noting that laboratory-synthesized genes are “designer genes,” but this is a common term. Search the Internet using the keywords “designer genes,” and many scientific (and unscientific) sites will be found.
6. A genomic library of the sentence you are now reading would be all of the sentence fragments that make up the sentence. One could string together all of the words of this first sentence, without spaces between letters, and then conduct a word-processing edit placing a space between any place where an “e” is followed by the letter “n” The resulting fragments of this original sentence would look like this, and would be like a type of “genomic library.”
Age nomiclibraryofthese nte nceyouare nowreadingwouldbeallofthese nte ncefragme ntsthatmadeupthese nte nce.
7. Some Internet search programs rely upon a methodology similar in one way to the use of a nucleic acid probe. For example, if you want to find the lyrics to a particular song, but you do not know the song title or artist, you might search the Internet using a unique phrase from the song. (For example, search using “yellow submarine”.) The search engine will scan millions of web pages to identify those sites containing that particular phrase. However, unlike a nucleic acid probe, you would search for the song by using a few of the lyrics. A nucleic acid probe would search using a sequence complementary to the desired sequence.
8. Roundup Ready Corn, a product of Monsanto, is resistant to the herbicide Roundup. The general strategy for farmers is to spray fields of Roundup Ready corn with the herbicide Roundup, killing weeds but not the corn. A search of the Internet will quickly reveal the controversy associated with this and other genetically modified organisms (GMO), which can encourage interesting discussions and promote critical thinking skills.
9. As gene therapy technology expands, our ability to modify the genome in human embryos, created through in vitro fertilization, permits genetic modification at the earliest stages of life. Future generations of humans, like our crops today, may include those with and without a genetically modified ancestry. The benefits and challenges of these technologies raise issues many students have never considered. Our students, and the generations soon to follow, will face the potential of directed human evolution.

23. DNA PROFILING AND FORENSIC SCIENCE
DNA profiling (fingerprinting):
Used to determine if two samples of genetic material are from same person
Scientific crime scene analysis
To produce a DNA profile
Scientists compare genetic markers
Sequences in the genome that vary from person to person.
Student Misconceptions and Concerns
1. Television programs might lead some students to expect that DNA profiling is quick and easy. Ask students to consider why DNA profiling actually takes many days or weeks to complete.
2. The many forms of DNA technology discussed in this chapter provide powerful evidence of evolution. Although not addressed regularly in this chapter, consider reminding students that these techniques continue to reinforce and inform our understandings of the common decent of life on Earth.
Teaching Tips
1. In most legal cases, the probability of two people having identical DNA profiles ranges from one in 100,000 to one in 1 billion or more. Yet, eyewitness testimony has been a standard part of the justice system. If you want to make the point about the unreliability of eyewitnesses in a trial, compared to techniques such as genetic profiling, consider this exercise. Arrange for a person who is not well known to the class to run into your classroom, take something you have placed near you (perhaps a bag, stack of papers, box), and leave quickly. You need to take care that no one in the class is so alarmed as to do something dangerous. Once the “thief” is gone, tell the class that this was planned but not to speak. Have them each write a description of the person, including height, hair color, clothing, facial hair, behavior, etc. Many students will be accurate, but some will likely get details wrong. This is also an effective exercise to demonstrate the need for large sample sizes and accurate recording devices for good scientific technique.
2. In PCR, the product becomes another master copy. Imagine that while you are photocopying, every copy is used as a master at another copy machine. (This would require many copy machines.)
3. Students might need a little more practice understanding the products of restriction enzymes. Consider these two words, equilibrium and equalibrium. Imagine that a mutation produced the spelling error of the second word. If we used a “restriction enzyme” that splits these words between “u” and “I” how will the fragments compare in size and number?
equilibrium = equ ilibri um (3 fragments of 3, 6, and 2 letters)
equalibrium = equalibri um (2 fragments of 9 and 2 letters)
4. Separating marker ink using paper chromatography is a simple experiment that approximates some of what occurs in gel electrophoresis. Consider doing this as a class demonstration while addressing electrophoresis. Cut a large piece of filter paper into a rectangle or square. Use markers to color large dots about 2 cm away from the edge of the paper. Separate the dots from each other by 3–4 cm. Place the paper on edge, dots down, into a beaker containing about 1 cm of ethanol or isopropyl alcohol (50% or higher will do). The dots should not be in contact with the pool of alcohol in the bottom of the beaker. As the alcohol is drawn up the filter paper by capillary action, the alcohol will dissolve the ink dots. As the alcohol continues up the paper, the ink follows. Not all of the ink components move at the same speed, based upon their size and chemical properties. If you begin the process at the start of class, you should have some degree of separation by the end of a 50-minute period. Experiment with the technique a day or two before class to fine-tune the demonstration, and experiment with different types of ink. (Save and air-dry these samples for your class.) Consider using brown, green, and black markers because these colors are often made by color combinations.

24. Investigating Murder, Paternity, and Ancient DNA
DNA profiling can be used to:
Test the guilt of suspected criminals
Identify tissue samples of victims
Resolve paternity cases
Identify contraband animal products
Trace the evolutionary history of organisms
Student Misconceptions and Concerns
1. Television programs might lead some students to expect that DNA profiling is quick and easy. Ask students to consider why DNA profiling actually takes many days or weeks to complete.
2. The many forms of DNA technology discussed in this chapter provide powerful evidence of evolution. Although not addressed regularly in this chapter, consider reminding students that these techniques continue to reinforce and inform our understandings of the common decent of life on Earth.
Teaching Tips
1. In most legal cases, the probability of two people having identical DNA profiles ranges from one in 100,000 to one in 1 billion or more. Yet, eyewitness testimony has been a standard part of the justice system. If you want to make the point about the unreliability of eyewitnesses in a trial, compared to techniques such as genetic profiling, consider this exercise. Arrange for a person who is not well known to the class to run into your classroom, take something you have placed near you (perhaps a bag, stack of papers, box), and leave quickly. You need to take care that no one in the class is so alarmed as to do something dangerous. Once the “thief” is gone, tell the class that this was planned but not to speak. Have them each write a description of the person, including height, hair color, clothing, facial hair, behavior, etc. Many students will be accurate, but some will likely get details wrong. This is also an effective exercise to demonstrate the need for large sample sizes and accurate recording devices for good scientific technique.
2. In PCR, the product becomes another master copy. Imagine that while you are photocopying, every copy is used as a master at another copy machine. (This would require many copy machines.)
3. Students might need a little more practice understanding the products of restriction enzymes. Consider these two words, equilibrium and equalibrium. Imagine that a mutation produced the spelling error of the second word. If we used a “restriction enzyme” that splits these words between “u” and “I” how will the fragments compare in size and number?
equilibrium = equ ilibri um (3 fragments of 3, 6, and 2 letters)
equalibrium = equalibri um (2 fragments of 9 and 2 letters)
4. Separating marker ink using paper chromatography is a simple experiment that approximates some of what occurs in gel electrophoresis. Consider doing this as a class demonstration while addressing electrophoresis. Cut a large piece of filter paper into a rectangle or square. Use markers to color large dots about 2 cm away from the edge of the paper. Separate the dots from each other by 3–4 cm. Place the paper on edge, dots down, into a beaker containing about 1 cm of ethanol or isopropyl alcohol (50% or higher will do). The dots should not be in contact with the pool of alcohol in the bottom of the beaker. As the alcohol is drawn up the filter paper by capillary action, the alcohol will dissolve the ink dots. As the alcohol continues up the paper, the ink follows. Not all of the ink components move at the same speed, based upon their size and chemical properties. If you begin the process at the start of class, you should have some degree of separation by the end of a 50-minute period. Experiment with the technique a day or two before class to fine-tune the demonstration, and experiment with different types of ink. (Save and air-dry these samples for your class.) Consider using brown, green, and black markers because these colors are often made by color combinations.

25. Figure 12.13-3 Crime scene Suspect 1 Suspect 2 DNA isolated
DNA amplified
Figure Overview of DNA profiling (Step 3)
DNA compared
Figure

26. DNA Profiling Techniques The Polymerase Chain Reaction (PCR)
Is a technique to copy quickly and precisely any segment of DNA
Can generate enough DNA, from even minute amounts of blood or other tissue, to allow DNA profiling
Student Misconceptions and Concerns
1. Television programs might lead some students to expect that DNA profiling is quick and easy. Ask students to consider why DNA profiling actually takes many days or weeks to complete.
2. The many forms of DNA technology discussed in this chapter provide powerful evidence of evolution. Although not addressed regularly in this chapter, consider reminding students that these techniques continue to reinforce and inform our understandings of the common decent of life on Earth.
Teaching Tips
1. In most legal cases, the probability of two people having identical DNA profiles ranges from one in 100,000 to one in 1 billion or more. Yet, eyewitness testimony has been a standard part of the justice system. If you want to make the point about the unreliability of eyewitnesses in a trial, compared to techniques such as genetic profiling, consider this exercise. Arrange for a person who is not well known to the class to run into your classroom, take something you have placed near you (perhaps a bag, stack of papers, box), and leave quickly. You need to take care that no one in the class is so alarmed as to do something dangerous. Once the “thief” is gone, tell the class that this was planned but not to speak. Have them each write a description of the person, including height, hair color, clothing, facial hair, behavior, etc. Many students will be accurate, but some will likely get details wrong. This is also an effective exercise to demonstrate the need for large sample sizes and accurate recording devices for good scientific technique.
2. In PCR, the product becomes another master copy. Imagine that while you are photocopying, every copy is used as a master at another copy machine. (This would require many copy machines.)
3. Students might need a little more practice understanding the products of restriction enzymes. Consider these two words, equilibrium and equalibrium. Imagine that a mutation produced the spelling error of the second word. If we used a “restriction enzyme” that splits these words between “u” and “I” how will the fragments compare in size and number?
equilibrium = equ ilibri um (3 fragments of 3, 6, and 2 letters)
equalibrium = equalibri um (2 fragments of 9 and 2 letters)
4. Separating marker ink using paper chromatography is a simple experiment that approximates some of what occurs in gel electrophoresis. Consider doing this as a class demonstration while addressing electrophoresis. Cut a large piece of filter paper into a rectangle or square. Use markers to color large dots about 2 cm away from the edge of the paper. Separate the dots from each other by 3–4 cm. Place the paper on edge, dots down, into a beaker containing about 1 cm of ethanol or isopropyl alcohol (50% or higher will do). The dots should not be in contact with the pool of alcohol in the bottom of the beaker. As the alcohol is drawn up the filter paper by capillary action, the alcohol will dissolve the ink dots. As the alcohol continues up the paper, the ink follows. Not all of the ink components move at the same speed, based upon their size and chemical properties. If you begin the process at the start of class, you should have some degree of separation by the end of a 50-minute period. Experiment with the technique a day or two before class to fine-tune the demonstration, and experiment with different types of ink. (Save and air-dry these samples for your class.) Consider using brown, green, and black markers because these colors are often made by color combinations.
How do you test if two samples of DNA come from the same person?
© 2010 Pearson Education, Inc.

27. Gel Electrophoresis Compares the lengths of varied DNA fragments
Uses gel electrophoresis, a method for sorting macromolecules—usually proteins or nucleic acids—primarily by their
Electrical charge
Size
Student Misconceptions and Concerns
1. Television programs might lead some students to expect that DNA profiling is quick and easy. Ask students to consider why DNA profiling actually takes many days or weeks to complete.
2. The many forms of DNA technology discussed in this chapter provide powerful evidence of evolution. Although not addressed regularly in this chapter, consider reminding students that these techniques continue to reinforce and inform our understandings of the common decent of life on Earth.
Teaching Tips
1. In most legal cases, the probability of two people having identical DNA profiles ranges from one in 100,000 to one in 1 billion or more. Yet, eyewitness testimony has been a standard part of the justice system. If you want to make the point about the unreliability of eyewitnesses in a trial, compared to techniques such as genetic profiling, consider this exercise. Arrange for a person who is not well known to the class to run into your classroom, take something you have placed near you (perhaps a bag, stack of papers, box), and leave quickly. You need to take care that no one in the class is so alarmed as to do something dangerous. Once the “thief” is gone, tell the class that this was planned but not to speak. Have them each write a description of the person, including height, hair color, clothing, facial hair, behavior, etc. Many students will be accurate, but some will likely get details wrong. This is also an effective exercise to demonstrate the need for large sample sizes and accurate recording devices for good scientific technique.
2. In PCR, the product becomes another master copy. Imagine that while you are photocopying, every copy is used as a master at another copy machine. (This would require many copy machines.)
3. Students might need a little more practice understanding the products of restriction enzymes. Consider these two words, equilibrium and equalibrium. Imagine that a mutation produced the spelling error of the second word. If we used a “restriction enzyme” that splits these words between “u” and “I” how will the fragments compare in size and number?
equilibrium = equ ilibri um (3 fragments of 3, 6, and 2 letters)
equalibrium = equalibri um (2 fragments of 9 and 2 letters)
4. Separating marker ink using paper chromatography is a simple experiment that approximates some of what occurs in gel electrophoresis. Consider doing this as a class demonstration while addressing electrophoresis. Cut a large piece of filter paper into a rectangle or square. Use markers to color large dots about 2 cm away from the edge of the paper. Separate the dots from each other by 3–4 cm. Place the paper on edge, dots down, into a beaker containing about 1 cm of ethanol or isopropyl alcohol (50% or higher will do). The dots should not be in contact with the pool of alcohol in the bottom of the beaker. As the alcohol is drawn up the filter paper by capillary action, the alcohol will dissolve the ink dots. As the alcohol continues up the paper, the ink follows. Not all of the ink components move at the same speed, based upon their size and chemical properties. If you begin the process at the start of class, you should have some degree of separation by the end of a 50-minute period. Experiment with the technique a day or two before class to fine-tune the demonstration, and experiment with different types of ink. (Save and air-dry these samples for your class.) Consider using brown, green, and black markers because these colors are often made by color combinations.

28. Shorter fragments travel through the gel faster than longer fragments
Mixture of DNA
fragments of
different sizes
Power
source
Gel
Completed gel
Band of
longest
(slowest)
fragments
shortest
(fastest)
Figure Gel electophoresis of DNA molecules (Step 3)
Shorter fragments travel through the gel faster than longer fragments
Fragments travel to positive end because phosphates in DNA are negatively charged
2 ways to analyze DNA in gel electrophoresis

29. Short Tandem Repeat (STR) Analysis
Short Tandem Repeats (STR’s)
Short repetitions (usually 4 nucleotides)
Number of repeats can vary from person to person
Used in DNA profiling/criminal investigations
FBI uses 13 repetitive sites on our DNA
Student Misconceptions and Concerns
1. Television programs might lead some students to expect that DNA profiling is quick and easy. Ask students to consider why DNA profiling actually takes many days or weeks to complete.
2. The many forms of DNA technology discussed in this chapter provide powerful evidence of evolution. Although not addressed regularly in this chapter, consider reminding students that these techniques continue to reinforce and inform our understandings of the common decent of life on Earth.
Teaching Tips
1. In most legal cases, the probability of two people having identical DNA profiles ranges from one in 100,000 to one in 1 billion or more. Yet, eyewitness testimony has been a standard part of the justice system. If you want to make the point about the unreliability of eyewitnesses in a trial, compared to techniques such as genetic profiling, consider this exercise. Arrange for a person who is not well known to the class to run into your classroom, take something you have placed near you (perhaps a bag, stack of papers, box), and leave quickly. You need to take care that no one in the class is so alarmed as to do something dangerous. Once the “thief” is gone, tell the class that this was planned but not to speak. Have them each write a description of the person, including height, hair color, clothing, facial hair, behavior, etc. Many students will be accurate, but some will likely get details wrong. This is also an effective exercise to demonstrate the need for large sample sizes and accurate recording devices for good scientific technique.
2. In PCR, the product becomes another master copy. Imagine that while you are photocopying, every copy is used as a master at another copy machine. (This would require many copy machines.)
3. Students might need a little more practice understanding the products of restriction enzymes. Consider these two words, equilibrium and equalibrium. Imagine that a mutation produced the spelling error of the second word. If we used a “restriction enzyme” that splits these words between “u” and “I” how will the fragments compare in size and number?
equilibrium = equ ilibri um (3 fragments of 3, 6, and 2 letters)
equalibrium = equalibri um (2 fragments of 9 and 2 letters)
4. Separating marker ink using paper chromatography is a simple experiment that approximates some of what occurs in gel electrophoresis. Consider doing this as a class demonstration while addressing electrophoresis. Cut a large piece of filter paper into a rectangle or square. Use markers to color large dots about 2 cm away from the edge of the paper. Separate the dots from each other by 3–4 cm. Place the paper on edge, dots down, into a beaker containing about 1 cm of ethanol or isopropyl alcohol (50% or higher will do). The dots should not be in contact with the pool of alcohol in the bottom of the beaker. As the alcohol is drawn up the filter paper by capillary action, the alcohol will dissolve the ink dots. As the alcohol continues up the paper, the ink follows. Not all of the ink components move at the same speed, based upon their size and chemical properties. If you begin the process at the start of class, you should have some degree of separation by the end of a 50-minute period. Experiment with the technique a day or two before class to fine-tune the demonstration, and experiment with different types of ink. (Save and air-dry these samples for your class.) Consider using brown, green, and black markers because these colors are often made by color combinations.

30. Figure 12.16 STR site 1 STR site 2 AGAT GATA Crime scene DNA
Same number of
short tandem repeats
Different numbers of
short tandem repeats
Suspect’s DNA
Figure Short tandem repeat (STR) sites
AGAT
GATA
Figure 12.16

31. Amplified Amplified crime scene suspect’s DNA DNA Longer fragments
Figure Visualizing STR fragment patterns
Shorter
fragments
Figure 12.18

32. RFLP Analysis
Before placed in the gel, DNA is mixed and cut by restriction enzymes
Individuals have unique restriction sites so DNA fragment lengths may vary
Used often to compare different gene alleles
Basis of some genetic and paternity tests
Student Misconceptions and Concerns
1. Television programs might lead some students to expect that DNA profiling is quick and easy. Ask students to consider why DNA profiling actually takes many days or weeks to complete.
2. The many forms of DNA technology discussed in this chapter provide powerful evidence of evolution. Although not addressed regularly in this chapter, consider reminding students that these techniques continue to reinforce and inform our understandings of the common decent of life on Earth.
Teaching Tips
1. In most legal cases, the probability of two people having identical DNA profiles ranges from one in 100,000 to one in 1 billion or more. Yet, eyewitness testimony has been a standard part of the justice system. If you want to make the point about the unreliability of eyewitnesses in a trial, compared to techniques such as genetic profiling, consider this exercise. Arrange for a person who is not well known to the class to run into your classroom, take something you have placed near you (perhaps a bag, stack of papers, box), and leave quickly. You need to take care that no one in the class is so alarmed as to do something dangerous. Once the “thief” is gone, tell the class that this was planned but not to speak. Have them each write a description of the person, including height, hair color, clothing, facial hair, behavior, etc. Many students will be accurate, but some will likely get details wrong. This is also an effective exercise to demonstrate the need for large sample sizes and accurate recording devices for good scientific technique.
2. In PCR, the product becomes another master copy. Imagine that while you are photocopying, every copy is used as a master at another copy machine. (This would require many copy machines.)
3. Students might need a little more practice understanding the products of restriction enzymes. Consider these two words, equilibrium and equalibrium. Imagine that a mutation produced the spelling error of the second word. If we used a “restriction enzyme” that splits these words between “u” and “I” how will the fragments compare in size and number?
equilibrium = equ ilibri um (3 fragments of 3, 6, and 2 letters)
equalibrium = equalibri um (2 fragments of 9 and 2 letters)
4. Separating marker ink using paper chromatography is a simple experiment that approximates some of what occurs in gel electrophoresis. Consider doing this as a class demonstration while addressing electrophoresis. Cut a large piece of filter paper into a rectangle or square. Use markers to color large dots about 2 cm away from the edge of the paper. Separate the dots from each other by 3–4 cm. Place the paper on edge, dots down, into a beaker containing about 1 cm of ethanol or isopropyl alcohol (50% or higher will do). The dots should not be in contact with the pool of alcohol in the bottom of the beaker. As the alcohol is drawn up the filter paper by capillary action, the alcohol will dissolve the ink dots. As the alcohol continues up the paper, the ink follows. Not all of the ink components move at the same speed, based upon their size and chemical properties. If you begin the process at the start of class, you should have some degree of separation by the end of a 50-minute period. Experiment with the technique a day or two before class to fine-tune the demonstration, and experiment with different types of ink. (Save and air-dry these samples for your class.) Consider using brown, green, and black markers because these colors are often made by color combinations.

33. RFLP PERSON A PERSON B ATGCTTAAGGCGTACACTGGATTTCTAGTACCTA
AATTCTAGTACCTA
GATCATGGAT
GAATTC
CTTAAG
EcoRI
ATGCTTAAGGCGTACACTGGATTTCTAGTACCTA
TACGAATTCCGCATGTGACCTTAAGATCATGGT T
ATGCTTAAGGCGTACACTG
TACGAATTCCGCATGTGACTTAA
ATGCTTAAGGCGTACACTGAATTCTAGTACCTA
TACGAATTCCGCATGTGACTTAAGATCATGGAT
PERSON A
PERSON B
Region cut into 2 fragments by EcoRI
Region not cut by EcoRI due to base substitution at restriction site.

34. Figure 12.19 Restriction enzymes added Crime scene DNA Suspect’s DNA
Fragment w
Cut
Fragment z
Fragment x
Cut
Cut
Fragment y
Fragment y
Figure RFLP analysis
Crime scene
DNA
Suspect’s
DNA
Longer
fragments z x w y y
Shorter
fragments
Figure 12.19

35. Lane 2 is mom, lane 5 is son so…who’s the daddy? 3 or 4?

36. For the test Cloning Stem cells Recombinant DNA What is it?
Reproductive vs. therapeutic cloning
How to do reproductive cloning (how did you clone mimi the mouse)
Stem cells
What are they?
Types of stem cells and their potential
Where do we find different types of stem cells such as adult, embryonic
What are IPS stem cells and why are they important?
Recombinant DNA
How do we make a recombinant plasmid?
What is it used for?

37. For the test PCR/gel electrophoresis Human genome project/Gene therapy
What are they used for?
How is a gel electrophoresis run?
How is a gel electrophoresis read?
Human genome project/Gene therapy
What are they?
For what do they hope to use these?

38. Table 12.1 Some Important Sequenced Genomes

39. The Human Genome Project
Begun in 1990, the Human Genome Project was a massive scientific endeavor:
To determine the nucleotide sequence of all the DNA in the human genome and
To identify the location and sequence of every gene
Student Misconceptions and Concerns
1. The text notes that there are 24 chromosomes in the human genome. Students might initially find this confusing, as it is common knowledge that humans have 23 pairs of chromosomes. Consider making the statement that we have 24 different types of chromosomes and asking your students to explain why this is true.
2. The similarities of the genotypes and phenotypes of members of a human family tree are expected and understood by most students. Yet, for many students, these same relationships are often poorly extrapolated to phylogenetic relationships of other groups. The use of genomics to test phylogenetic relationships is an enormously powerful tool using in modern systematics. Genomics is a significant test of the other overwhelming types of evidence for evolution.
Teaching Tips
1. The first targets of genomics were prokaryotic pathogenic organisms. Consider asking your students in class to suggest the reasons why this was a good choice. Students will likely note that the genomes of these organisms are smaller than eukaryotes and that many of these organisms are of great medical significance.
2. The authors note that there are 3.2 billion nucleotide pairs in the human genome. There are about 3.2 billion seconds in years. This simple reference might add meaning to the significance of these large numbers.
3. The main U.S. Department of Energy Office website in support of the human genome project is found at
4. The website for the National Center for Biotechnology Information, is ( The center, established in 1988, serves as a national resource for biomedical information related to genomic data.
5. Challenge students to explain why a complete understanding of an organism’s genome and the resulting proteins produced is still not enough to understand the full biology of an organism. Challenge them to consider the role of the environment in development and physiology. (One striking example of the influence of the environment is that the sex of some reptiles is determined not by genetics, but by incubation temperature!)
6. With a better understanding of the diverse and still unknown roles of many sections of DNA, consider discussing some of the difficulties of “resurrecting” extinct organisms from incomplete DNA sequences.

40. HUMAN GENE THERAPY Human gene therapy: Is a recombinant DNA procedure
Seeks to treat disease by altering the genes of the afflicted person
Often replaces or supplements the mutant version of a gene with a properly functioning one
Student Misconceptions and Concerns
1. Using gene therapy to “fix” genetic problems relies upon a thorough understanding of the roles of genes and alleles. Students might benefit from a discussion of the extent to which we as a society might want to consider directing our own genetics.
Teaching Tips
1. Ethical, legal, and social issues related to the human genome project are directly addressed at the Department of Energy Human Genome website at
2. The Biology and Society end-of-chapter textbook questions address some of the issues raised in this chapter section.

41. Figure 12.24-1 Normal human gene isolated and cloned Healthy person
Figure One approach to human gene therapy (Step 1)
Healthy person
Figure

42. Figure 12.24-2 Normal human gene isolated and cloned Harmless
virus (vector)
Normal human
gene inserted
into virus
Virus containing
normal human gene
Figure One approach to human gene therapy (Step 2)
Healthy person
Figure

43. Figure 12.24-3 Normal human gene isolated and cloned Harmless
virus (vector)
Normal human
gene inserted
into virus
Virus containing
normal human gene
Figure One approach to human gene therapy (Step 3)
Bone
marrow
Healthy person
Bone of person
with disease
Virus injected
into patient with
abnormal gene
Figure

44. SCID – severe combined immune deficiency
SCID is a fatal inherited disease caused by a single defective gene that prevents the development of the immune system.
SCID patients quickly die unless treated with:
A bone marrow transplant or
Gene therapy
Student Misconceptions and Concerns
1. Using gene therapy to “fix” genetic problems relies upon a thorough understanding of the roles of genes and alleles. Students might benefit from a discussion of the extent to which we as a society might want to consider directing our own genetics.
Teaching Tips
1. Ethical, legal, and social issues related to the human genome project are directly addressed at the Department of Energy Human Genome website at
2. The Biology and Society end-of-chapter textbook questions address some of the issues raised in this chapter section.

45. SCID and gene therapy Since the year 2000, gene therapy has:
Cured 22 children with inborn SCID but
Unfortunately, caused four of the patients to develop leukemia, killing one of these children
Student Misconceptions and Concerns
1. Using gene therapy to “fix” genetic problems relies upon a thorough understanding of the roles of genes and alleles. Students might benefit from a discussion of the extent to which we as a society might want to consider directing our own genetics.
Teaching Tips
1. Ethical, legal, and social issues related to the human genome project are directly addressed at the Department of Energy Human Genome website at
2. The Biology and Society end-of-chapter textbook questions address some of the issues raised in this chapter section.