Download presentation
Presentation is loading. Please wait.
1
Forensics DNA SCIENCE
2
What We Will Study Patterns of Inheritance The Molecule DNA (deoxyribonucleic acid) DNA’s use in Forensics Who Dunnit (DNA Lab)
3
Patterns Of Inheritance
All living things possess physical and behavioral characteristics called traits. *Hair Color *Taste *How Fast a Person Angers
4
Each trait is inherited from an organism’s ancestors.
The trait moves from one organism to another via a piece of DNA called a gene. Genes are passed down from generation to generation through the reproductive process.
5
Organisms that are created through sexual reproduction have two parents so it would stand to reason they have at least two different genes for each trait. Because each organism has many thousands of different genes, and there are two parents organisms, that means each new organism is unique. (It contains its own unique DNA pattern.)
6
Facts DNA comes in packages called Chromosomes
Different organisms have different numbers of chromosomes. Humans have 23 pair of chromosomes. 23 come from the biological father 23 come from the biological mother This means you have 2 number one chromosomes, 2 number two chromosomes etc.
7
All human DNA is 99.9% identical.
It is the 0.1% that makes us all different. No two humans have the same DNA unless they are identical twins
8
Review List five traits you have.
How many genes do you have for each trait? Where did you get these genes? A gene is a piece of ____. DNA come in packages called ______. Humans have 23 pairs of _______. The letters DNA stand for _____ ____ ____ How much of your DNA is unique to you? Can identical twins have identical DNA?
9
DNA is constructed into a code for all of an organism’s traits.
There is a certain code for red hair. There is a certain code for eye color There is even a certain code for finger length. (Compare the length of your pointer finger compared to the length of your ring finger. Which is longer? Check with your classmates to see if they all have the same results.)
10
Traits come from parts of DNA called “Genes”.
Genes are simple stretches of DNA that code for a particular characteristic, (trait). On one strand of DNA there may be thousands of genes. 5% of human DNA is made of genes.
11
Genes even code for things that are not easy to see like mathematical ability and quality of memory.
To Summarize: DNA Genes Chromosomes
12
Chromosomes Each individual chromosome is made of gigantic, long strings of DNA. The DNA is wound around proteins and in the end takes the shape of an “X”. A housefly has 8 chromosomes and a corn plant has 20. Abnormal numbers of chromosomes in an individual organism causes major biological problems.
13
All genetic information is passed from generation to generation through chromosomes.
Chromosomes contain two types of DNA Coding DNA – this DNA makes up genes. Non-Coding or Junk DNA – this is non-genic DNA Both types of DNA are very useful in a scientific sense
14
It is the information in chromosomes that make them useful in forensics. Since no two people have the same DNA, any blood or bodily fluids left at a crime scene provide an identification tag . DNA information is so powerful that trial juries give DNA evidence a tremendous amount of weight in their decision making.
15
DNA (The Molecule) The DNA molecule was first defined in the 1960s by two scientists, James Watson and Francis Crick. (Crick was British and Watson an American) It is one of the most important discoveries in human history and they won a Nobel prize for their efforts.
16
They found that the molecule is actually shaped like a right-hand twisted ladder, helix, or spiral.
17
Review… Explain what chromosomes are made up of.
Draw the general shape of DNA and identify where the proteins are. Explain the two types of DNA and their purposes. Who and when was DNA first discovered. What year was DNA first used in a criminal case?
18
The ladder is made from four different molecules called “nucleotides”.
Each nucleotide is made of three parts. Phosphate Pentose, (5 sided) sugar One of four nitrogenous bases.
19
phosphate Nitrogenous Base Pentose Sugar
20
What makes one of the four nucleotides different from the next is the nitrogenous base it possesses.
The four bases are as follows: Adenine Cytosine Guanine Thymine
21
phosphate Pentose Sugar Adenine phosphate Cytosine Pentose Sugar
22
phosphate Guanine Pentose Sugar phosphate Thymine Pentose Sugar
23
As the molecule assembles itself, it does so in a 2 sided fashion.
Watson and Crick found that when they looked at the nucleotides, one thing was obvious. The nucleotide adenine was ALWAYS bonded to the nucleotide thymine and cytosine was always bonded to guanine.
24
Not only is adenine always bonded to thymine, it is bonded with 2 hydrogen bonds
P P S Adenine Thymine S
25
Not only is cytosine always bonded to guanine, it is bonded with 3 hydrogen bonds
P P S cytosine guanine S
27
Review… Explain the shape of a DNA molecule.
Identify the three parts of a nucleotide. Show how these 3 parts are connected to each other. What are the four nitrogenous bases in DNA? Which bases bond to which bases? What type of bond is between the pairs of bases? Identify which base pairs have double bonds and which have triple bonds.
28
Not only is the DNA shaped like a ladder, the ladder actually twists as shown below.
BACKBONE CYTOSINE THYMINE GUANINE N BONDS ADENINE
29
Fill in the other side of the DNA Molecule.
Fill in the matching nucleotides and include the hydrogen bonding. A C G C T C A A G C T A C C T A T C
30
Functions of DNA DNA: Stores and passes genetic information from generation to generation. Runs all cellular activity. Changes (undergoes mutation)
31
AACTCTGGGCAAATCGATCCG
AACTCTGCGCAATTCGAGCGC As you can see, there are only a few nucleotides that are different. BUT these few different nucleotides cause changes in eye color, height. Intelligence, - all kinds of things
32
How is DNA used as evidence?
Each person’s DNA is different from other people (except identical twins). DNA collected from a crime scene can either link a suspect to the evidence or eliminate a suspect, similar to the use of fingerprints. DNA can identify a victim through DNA from relatives, even when no body can be found. DNA can link crime scenes together by linking the same perpetrator to different scenes locally, statewide, and across the nation. DNA can place an individual at a crime scene, in a home, or in a room where the suspect claimed not to have been. DNA can refute a claim of self-defense and put a weapon in the suspect's hand. It can change a story from an alibi to one of consent. DNA Strand Image & information :
33
What factors affect DNA evidence?
Several factors can affect the DNA left at a crime scene, such as environmental factors (e.g., heat, sunlight, moisture, bacteria, and mold). Therefore, not all DNA evidence will result in a usable DNA profile. Further, DNA testing cannot identify when the suspect was at the crime scene or for how long. CODIS stands for COmbined DNA Index System, which is an electronic database of DNA profiles that can identify suspects. DNA profiles from individuals convicted of certain crimes, such as rape, murder, and child abuse, are entered into CODIS and help officers identify possible suspects when no prior suspect existed. What is CODIS? Did you know? Each human cell contains three billion DNA base pairs. Our unique DNA amounts to 0.1% or 3 million base pairs. DNA information :
34
REVIEW…. Name 6 ways DNA is used as evidence.
What factors affect DNA evidence? How long can DNA sample be reliable? When was the first DNA evidence used in a court case? Write what CODIS stands for and explain what it is.
35
Which sets of twins are identical twins? A. Who done it?
C. Identical or not? Which sets of twins are identical twins? A. Who done it? Which suspect matches the bloodstain? B. Whose your daddy? Which sample is most likely to be the father? F1 or F2 Information & image from
36
Which three statements below are true?
True or False? Which three statements below are true? 1. The DNA in a man's blood is the same as the DNA in his skin cells and saliva. 2. Each person's DNA is different from every other individual's. 3. DNA can be found in all the cells in our bodies except the blood cells. 4. DNA can have forensic value even if it is decades old. 5. DNA evidence was first used to get a conviction in a trial in 1987. Watch the video segment from NOVA: "The Killer's Trail" and be ready to answer the questions on the next slide. Video available at Nova_Killer Trail.zip More information available at
37
Choose the best answer for each.
Video Quiz Choose the best answer for each. 1. Who was the victim? A. Marilyn Sheppard B. Sam Sheppard C. Sam Sheppard, Jr. 2. What are the keys to DNA fingerprinting? Chromosomes B. Alleles C. Nitrogen bases 3. Where did the scientist get the sample of DNA for Marilyn Sheppard? A. Hair B. Skin C. Fingernail 4. Whose blood was found in the blood trail? A. Marilyn Sheppard B. Sam Sheppard C. Neither
38
Secret of Photo 51 Fill in the worksheet:
39
Review List five traits you have.
How many genes do you have for each trait? Where did you get these genes? A gene is a piece of ____. How much of DNA is made up of gene? DNA come in packages called ______. Humans have 23 pairs of _______. The letters DNA stand for _____ ____ ____ How much of your DNA is unique to you? Can identical twins have identical DNA?
40
Review… Explain what chromosomes are made up of.
Draw & describe the general shape of DNA and identify where the proteins are. Explain the two types of DNA and their purposes. Who and when was DNA first discovered. What year was DNA first used in a criminal case?
41
Review… Explain the shape of a DNA molecule.
Identify the three parts of a nucleotide. Show how these 3 parts are connected to each other. What are the four nitrogenous bases in DNA? Which bases bond to which bases? What type of bond is between the pairs of bases? Identify which base pairs have double bonds and which have triple bonds.
42
DNA Replication LT2
43
Functions of DNA DNA: Stores and passes genetic information from generation to generation. Runs all cellular activity. Changes (undergoes mutation)
44
DNA REPLICATION DNA passes genetic information from generation to generation. It manages this by going through a process called DNA Replication. Replication occurs just before the Cell containing the DNA splits into 2 new cells. (Remember – every cell has to have the right amount of ‘DNA of there will be problems.) Human cells have 46 chromosomes. Just before a cell divides into two cells it makes a copy of its DNA, (92 chromosomes). It divides into two new cells, each with 46 chromosomes.
45
Replicating DNA is not hard to understand. There are only 5 easy steps
1. Unwind the DNA ladder. (Enzyme) 2. Unzip the DNA Molecule. (Enzyme) 3. Complementary Base pair the nucleotides. (Enzyme) 4. Rezip the new molecule. (Enzyme) 5. Rewind the new molecules. (Enzyme)
46
A protein called an enzyme unwinds the DNA.
Step 1 A protein called an enzyme unwinds the DNA. It was a twisted ladder – now it is just a ladder Step 2 Another enzyme unzips the DNA at a particular point.
47
Step 3 Complimentary Base Pairing
Now that the DNA is open, nucleotides, always present in the cell, complimentary base pair to their partners. Adenines bond to thymines Cytosines bond to Guanines
48
This DNA has been unwound and unzipped.
C G T A G C A T C G A T
49
Complementary nucleotides come in and match up with their partners.
G G C T A A T G C C G A A T T C G C G A T A T
50
Now the new nucleotides are joined together to for a new strand of DNA
51
Step 4 Once the new nucleotides have lined up correctly, (As with Ts and Cs with Gs), an enzyme joins the sides together to make two exact DNA molecules.
52
Step 5 The 2 new molecules rewind into normal twisted ladder shapes….
53
This is important. It guarantees genetic consistency.
Now that the molecule has been copied, the cell can divide in two and each new cell will have an EXACT copy of the original cells DNA. This is important. It guarantees genetic consistency. Damaged skin cells will be replaced with skin cells. Humans will always give birth to humans.
54
So now we know that humans possess 23 pair of chromosomes and 99
So now we know that humans possess 23 pair of chromosomes and 99.9% of human DNA is identical. This being the case – why do we look so different? What makes us different is the order of the DNA base pairs in that .1% of DNA that is different. In a particular gene, one person will have this order of base pairs. AACTCTGGGCAAATCGATCCG Another person may have the following order. AACTCTGCGCAATTCGAGCGC
55
Use of DNA Replication in Anthropology… Ancient DNA - Bringing the Past to Life:
56
Review… Name 3 functions of DNA.
DNA passes genetic information from generation to generation. It manages this by going through a process called__________. List the 5 steps in this process.
Similar presentations
© 2024 SlidePlayer.com. Inc.
All rights reserved.