1. Tuesday, the 10th of September, 2013
Traitement de Séquences
Brutes NGS
Nettoyage, alignement, polymorphisme
François Sabot
Tuesday, the 10th of September, 2013
Alexis Dereeper, François Sabot

2. Tuesday, the 18th of October, 2012
BUT du TD:
1- Galaxy vs Ligne de Commande
2- Comprendre un fichier FASTQ
3- Nettoyer des données Illumina/FASTQ
4- Comprendre un assemblage
5- Effectuer un mapping de séquences Illumina sur une Référence
6- Nettoyer un fichier SAM multiple
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

3. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

4. Serveur IRD: http://bioinfo-master.ird.fr:8080/
1- Galaxy
Serveur IRD:
Serveur principal:
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

5. Tuesday, the 18th of October, 2012
OUTILS
DONNÉES
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

6. Tuesday, the 18th of October, 2012
WEB SERVICE
- système en “Click'n'Play”
- transparent pour l'utilisateur
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

7. Tuesday, the 18th of October, 2012
WEB SERVICE
- système en “Click'n'Play”
- transparent pour l'utilisateur
MODULAIRE
- briques de base nombreuses
- ajout de briques personalisables
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

8. Tuesday, the 18th of October, 2012
WEB SERVICE
- système en “Click'n'Play”
- transparent pour l'utilisateur
MODULAIRE
- briques de base nombreuses
- ajout de briques personalisables
MULTIPLE
- basé sur serveur web (Apache...)
- sur machine unique, cluster...
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

9. Tuesday, the 18th of October, 2012
WEB SERVICE
- système en “Click'n'Play”
- transparent pour l'utilisateur
MODULAIRE
- briques de base nombreuses
- ajout de briques personalisables
MULTIPLE
- basé sur serveur web (Apache...)
- sur machine unique, cluster...
MAIS
- Appui simple
- Beaucoup moins puissant que terminal
- Seulement pour analyse en routine
- Seulement pour données limitées
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

10. Tuesday, the 18th of October, 2012
CONNEXION POUR LE TD:
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

11. Tuesday, the 18th of October, 2012
Se Connecter...
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

12. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

13. Tuesday, the 18th of October, 2012
Ajouter des données...
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

14. Tuesday, the 18th of October, 2012
Importer des données depuis des bibliothèques de Galaxy
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

15. Tuesday, the 18th of October, 2012
Importer des données depuis des bibliothèques de Galaxy
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

16. Tuesday, the 18th of October, 2012
Création de WorkFlow pour analyses automatisées
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

17. Fichier FASTQ → Fichier TEXTE Tuesday, the 18th of October, 2012
STRUCTURE:
@HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA
CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT +
cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb
@HWUSI-EAS454_0006:1:37:16314:3410#CTTGTA
AGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGTGGTGGCCG
`bTbbccccceeeeeceeeecccYeedded`ceec]dddde^a`deeeec\`dddcbaadadYd`]]Jc_^bc^^\
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

18. Tuesday, the 18th of October, 2012
@HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA
CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT +
cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

19. Tuesday, the 18th of October, 2012
NOM DE LA SEQUENCE
@HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA
CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT +
cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

20. Tuesday, the 18th of October, 2012
SEQUENCE IUPAC
@HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA
CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT +
cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

21. Tuesday, the 18th of October, 2012
@HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA
CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT +
cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

22. Tuesday, the 18th of October, 2012
@HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA
CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT +
cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb
QUALITÉ ASCII
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

23. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

24. Tuesday, the 18th of October, 2012
@HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA
CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT +
cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

25. Tuesday, the 18th of October, 2012
@HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA
CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT +
cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb
f → Qualité de 38
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

26. Tuesday, the 18th of October, 2012
WHAT IS QUALITY ?
Quality value Q is an integer mapping of p (i.e., the probability that the corresponding base call is incorrect).
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

27. FASTQC: contrôle de la qualité Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

28. FASTQC: contrôle de la qualité Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

29. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

30. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

31. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

32. Tuesday, the 18th of October, 2012
Pourquoi nettoyer ?
Enlever les adaptateurs/primers restants et
les séquences de mauvaise qualité
→ CutAdapt
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

33. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

34. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

35. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

36. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

37. Tuesday, the 18th of October, 2012
Sequences from Solexa_adapters, one per one
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

38. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

39. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

40. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

41. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

42. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

43. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

44. Tuesday, the 18th of October, 2012
Vos données sont prêtes a l'emploi...
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

45. Tuesday, the 18th of October, 2012
Séparation des séquences par individus d'origine RC1, RC2...
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

46. Tuesday, the 18th of October, 2012
Séparation des séquences par individus d'origine RC1, RC2...
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

47. Tuesday, the 18th of October, 2012
Séparation des séquences par individus d'origine RC1, RC2...
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

48. Tuesday, the 18th of October, 2012
Séparation des séquences par individus d'origine RC1, RC2...
Utilisation d'expression rationelle via Galaxy:
→ RS|RC[ ] & remove reads => conserve RC2
→ RS|RC[ ]|RC1_ & remove reads => conserve RC10
→ RS|RC[ ]|RC10 & remove reads => conserve RC1
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

49. Tuesday, the 18th of October, 2012
Mapping: Positionner les lectures 'pair-end' sur une référence
1- Calcul des positions de chaque lecture
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

50. Tuesday, the 18th of October, 2012
Mapping: Positionner les lectures 'pair-end' sur une référence
1- Calcul des positions de chaque lecture
2- Mise en relation des positions de chaque membre de la paire
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

51. Tuesday, the 18th of October, 2012
Mapping: Positionner les lectures 'pair-end' sur une référence
1- Calcul des positions de chaque lecture
2- Mise en relation des positions de chaque membre de la paire
3- Sélection de la position la plus probable
respectant les conditions
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

52. Tuesday, the 18th of October, 2012
Mapping: Positionner les lectures 'pair-end' sur une référence
1- Calcul des positions de chaque lecture
2- Mise en relation des positions de chaque membre de la paire
3- Sélection de la position la plus probable
respectant les conditions
4- Édition d'un fichier de sortie SAM
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

53. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

54. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

55. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

56. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

57. Tuesday, the 18th of October, 2012
Reference From History:
Shared data/Formation/PreProcess/ref.fasta
Library:
Paired-end
FASTQ files:
Depuis votre historique
BWA setting to use:
Commonly Used
Décocher “Suppress the header in the output SAM file”
Cliquer
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

58. Tuesday, the 18th of October, 2012
Sortie en fichier SAM (Sequence Alignment/Map)
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

59. Tuesday, the 18th of October, 2012
Tri du fichier SAM par coordonnées
NE MARCHE PAS
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

60. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

61. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

62. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

63. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

64. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

65. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

66. Tuesday, the 18th of October, 2012
Workflow: comment éviter de tout refaire à la main
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

67. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

68. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

69. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

70. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

71. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

72. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

73. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

74. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

75. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot

76. Tuesday, the 18th of October, 2012
François Sabot
Tuesday, the 18th of October, 2012
Alexis Dereeper, François Sabot